Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

About us

YASARA is brought to you by YASARA Biosciences in close collaboration with the WHAT IF Foundation and Spronk NMR Consultancy . Our final goal is to advance science by providing the community with the required research tools. WHAT IF and YASARA are aimed at becoming an all-in-one solution that takes the steps from protein sequence to structure to function to drug design, and is nevertheless powerful enough to handle the large amounts of data required by structural and functional genomics projects. Due to the enormous size of the problem, collaborations with other research groups are always welcome. We generally use scientific results instead of sales-departments to convince our customers. This approach saves a lot of money, which in turn allows us to offer the software for free or at realistic, non-fantasy prices (depending on the product), for academic as well as industrial environments. Any new methods used in our programs are published in peer-reviewed journals, so that you never have to rely on brochures instead of scientific facts. By obtaining software directly out of the research lab, you can be sure not to waste money on a program whose development essentially stopped five years ago - far too long in this rapidly evolving field.
If you want to contact us, just click here.


YASARA Biosciences

WHAT IF Foundation

Spronk NMR Consultency




Elmar Krieger

Development of YASARA was started in 1993  by Elmar Krieger, together with his study of Molecular Biology at the University of Graz, Austria. In 1997, YASARA became the topic of his master's thesis, supervised by Prof. Günther Koraimann. In 2000, YASARA moved to the Center for Molecular and Biomolecular Informatics (CMBI) in Nijmegen, the Netherlands, where Elmar became PhD student of Prof. Gert Vriend. In 2002, Elmar founded YASARA Biosciences, a company located in Austria, with the aim to develop, distribute and support YASARA. Since 2003, WHAT IF and YASARA work closely together in the Twinset , providing you, the user, with over 40 man years of protein modeling expertise at the touch of a button. Since 2006, a tight collaboration with Spronk NMR Consultancy ensures that YASARA's NMR module employs the latest advances in the field.



Elmar KriegerJacobus "Koos" van Meel became CTO of YASARA Biosciences in April 2010. He studied Physics at the University of Vienna, Austria. In 2005,  Koos moved to the FOM Institute  for Atomic and Molecular Physics (AMOLF) in Amsterdam, The Netherlands, where he did extensive in silico studies on the enhancement and suppression of crystal nucleation, and received his PhD in 2009. Koos has broad experience in all of YASARA's core technologies, ranging from large-scale C/C++ development (acquired during three years as software architect at BOC Information Systems in Vienna), to OpenGL graphics programming and general GPU computing. In 2007, he was among the first to publish an article about the implementation of a complete molecular dynamics algorithm on the graphics card using CUDA.


Gert VriendGert Vriend started programming WHAT IF in 1987 as a PostDoc in Groningen, the Netherlands. In 1989, he moved to the EMBL in Heidelberg, joining the group of Chris Sander. From 1996 on, he led the 'Vriend group' and, together with his students, added an  uncountable number of options to the program. Since 2000, he is 'Professor of Bioinformatics' and head of the Center for Molecular and Biomolecular Informatics (CMBI) in Nijmegen, the Netherlands. Elmar Krieger (on the left) was his first PhD student there. The WHAT IF Foundation is a non-profit organization founded in 1992, that uses revenues from WHAT IF sales to ensure further WHAT IF development and to support students.


Chris SpronkChris Spronk graduated in biophysical chemistry and biochemistry at the Radboud University in Nijmegen, The Netherlands. He then specialized in biomolecular NMR spectroscopy, as well as method development in structure refinement & validation during subsequent PhD and post-doctoral research periods at the Department of NMR-spectroscopy (Utrecht University), the Department of Biophysical Chemistry and the Center for Molecular and Biomolecular Informatics (Radboud University in Nijmegen). In 2006 he founded Spronk NMR Consultancy to provide his experience to partners from academia and industry.

Contact address:

YASARA Biosciences GmbH
Dr. Elmar Krieger
Wagramer Strasse 25/3/45
1220 Vienna
Austria / Europe
VAT-Number: ATU65614837

www.yasara.org
Email Elmar Krieger

Contact address:

WHAT IF Foundation / CMBI
Prof. Gert Vriend
Toernooiveld 1
6525 ED Nijmegen
The Netherlands
VAT-Number: NL003634255B02

www.cmbi.kun.nl/whatif
Email Gert Vriend

Contact address:

Spronk NMR Consultency
Dr. Chris Spronk
Pylimo gatvė 6
LT-01117, Vilnius
Lithuania

www.spronknmr.eu
Email Chris Spronk