Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Automatic force field parameter assignment in YASARA

The AutoSMILES algorithm

With AutoSMILES , YASARA provides an advanced approach to simulate 98% of the PDB at the touch of a button (manual intervention is needed for proteins with a Calpha only backbone or very exotic metal ions). AutoSMILES employs SMILES strings to identify known molecules (even if residue and atom names differ) and resorts to the AM1BCC[1] and GAFF[2] (General AMBER force field) approaches for all other molecules. AM1BCC charges are additionally improved by using known RESP charges of similar molecule fragments, again identified via SMILES strings.

The individual AutoSMILES steps can be summarized as follows:
  1. Assignment of pH dependent fractional bond orders and protonation patterns , typing of ring systems by a graph-theoretic approach.
  2. Identification of known molecules (from the force field definition file or the AMBER Parameter Database) using SMILES strings. If no hit is found, proceed to step 3.
  3. Calculation of semi-empirical AM1 Mulliken point charges[3]. This step involves a geometry optimization with the COSMO solvation model[4] and avoids fatal rearrangements sometimes found when optimizing highly charged molecules like ATP(4-) in vacuo.
  4. Assignment of AM1BCC atom- and bond types.
  5. Application of the 'AM1 Bond Charge Correction' to improve the AM1 charges and make them better represent the electrostatic potential around the molecule - just like RESP charges.
  6. Further improvement of the AM1BCC charges using the known ideal RESP charges of similar molecule fragments, identified via SMILES strings.
  7. Assignment of GAFF (General AMBER Force Field) atom types and remaining force field parameters.
  8. In the end, the newly created parameters are cached for instantaneous availability next time.

Since all this is done automatically, only one step is required in practice: Press <F12> to run the simulation. YASARA also produces a detailed force field parameter assignment report, including PREP topologies and FRCMOD files for all newly parameterized molecules, that can be plugged directly into other MD programs like AMBER.

AutoSMILES is an integral part of YASARA Dynamics and can additionally be tested via a web server.

R E F E R E N C E S

[1] Fast, efficient generation of high-quality atomic charges. AM1-BCC model: II. Parameterization and validation
Jakalian A, Jack DB and Bayly CI (2002) J Comput Chem 23,1623-1641
[2] Development and Testing of a General Amber Force Field
Wang J, Wolf RM, Caldwell JW, Kollman PA and Case DA (2004) J Comput Chem 25, 1157-1174.
[3] MOPAC: A semiempirical molecular orbital program
Stewart JJP (2000) J.Comp.Aided Mol.Des. 4,1-103
[4] Conductor-like screening model for real solvents: a new approach to the quantitative calculation of solvation phenomena
Klamt A (1995) J.Phys.Chem. 99, 2224-2235