Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 


List of new features up to version 8.6.29

Here you can check which improvements to expect from a YASARA update. The list below only contains new features and major bug fixes since the first publically available release (3.9.1), small changes are not included.


VersionNew feature
8.6.21Workaround for a bug in some new ATI drivers that left the startup screen visible and did not clear the screen.
8.6.8New command: 'SupOrdered' superposes an arbitrary number of selections in an ordered way. Click Analyze > Superpose > Two objects on ordered...
8.6.6Fixed a problem with running 'Experiment Neutralization' multiple times on the same protein: pKa predictions from the first run were reused for subsequent runs, even if the protein conformation had changed.
8.5.29Improved selection language: the 'with occurrence in' operator selects atoms that occur in both selections, see Selections > Selections can be combined with explicit operators.
8.5.27New command: 'GDT' calculates the CASP global distance test, i.e. the percentage of atoms that can be superposed below a certain distance cutoff. Click Analyze > Global distance test of (Model+).
8.5.26Improved commands: 'BuildRes', 'SwapRes' and 'AddRes' accept a new 'Isomer' parameter to build also D-amino acids.
8.5.25Fixed a matching problem in 'Sup' and 'RMSD' that occured when more than two objects were superposed with 'Match=Yes', i.e. an RMSD matrix was calculated.
8.5.7New command: 'ElementAtom' gets the chemical element of selected atoms.
8.5.6Improved command: 'RadiusObj' can also obtain the radii of polygon meshes.
8.4.15New command: 'SavePNG' saves a screenshot in compressed PNG format.
8.3.30Improved command: 'Align' initializes the atomic properties to reflect sequence similarity between aligned residues. Coloring by properties thus helps to visualize the structural alignment.
8.3.27Improved command: The minimization experiment supports a new convergence parameter to define how far the minimization should proceed.
8.3.11Improved command: The 'Label' format supports a new 'CHARGE' keyword to display charges of entire units. 'ATOMCHARGE' is deprecated.
8.3.3Improved command: 'Clean' sorts atoms in amino acids in their default order.
8.3.1Reduced CPU usage on some graphics cards, e.g. nVIDIA.
8.2.21Improved selections: the properties 'Ring', 'Aromatic' and 'Visible' are now available in atom selection menus.
8.2.19Improved command: 'SupMulti' now employs the latest version 1.2.7 of Theseus (Linux+MacOSX).
8.2.14Improved YAMBER3 force field: Stronger planarity constraints significantly increase structural quality with only a marginal effect on accuracy.
8.2.10Improved typing of small molecules: 27 additional difficulties are now handled.
8.2.3New feature: the 'SolvEnergy' command also calculates the Van der Waals solvation energy and returns it as the second result. A surface area is no longer returned, PLEASE UPDATE macros that use the second return value.
8.2.2Improved macros: The examples macros at the 'BindEnergy' command now include Van der Waals solvation energies and the entropic cost of exposed surface.
8.2.1Improved command: 'Rotate' can now also rotate atoms in the local coordinate system, the order of rotation is now about the X-, Z- and Y-axes.
8.1.31New command: 'GroupLine' calculates the optimal line through a group of atoms, for example to move atoms along a helical axis.
8.1.30Improved command: 'Clean' corrects incorrectly defined chemical elements, like OD2 ASP A 186 in 1F6W.
8.1.29New command: 'GroupPlane' calculates the optimal plane through a group of atoms.
8.1.28Improved command: Per-atom energy calculations with 'EnergyAtom/Res/Mol' add the dihedral energy to the two dihedral core atoms 2 and 3 instead of 1 and 4. This makes sure that the Phi and Psi dihedral energies stay inside the amino acid they belong to. The same holds for bond angles now.
8.1.26Improved macro language: lists can be assigned to each other, e.g. MyOtherList=MyList.
8.1.20New highlight: YASARA supports side-by-side stereo (parallel and cross-eyed), click Window > Stereo (Model+).
8.1.18Improved command: 'AddRes' accepts a new 'End' parameter to add residues also to the front end of a peptide chain.
8.1.17Fixed an issue where LoadSim complained that simulation snapshots created in the second half of 2007 were corrupted.
8.1.10Improved feature: Object names can now be up to 12 characters long.
8.1.7New highlight: A scene content browser with context menus in the top right head-up display allows to easily and quickly navigate and modify the scene. As a side-effect, <Ctrl> needs to be held down when grabbing an object for movement in the HUD.
8.1.6Improved command: 'CheckObj Bumps' no longer considers crystal symmetry to avoid unexpected results.
8.1.5New commands: 'ShowHUD' and 'HideHUD' toggle the display of selected units in the scene content browser. Click Window > Show/Hide in HUD.
8.1.1New workaround for a backward compatibility bug in MacOSX 10.5. YASARA now also runs in Leopard.
7.12.27Improved support for non-ASCII characters in filenames (UTF-8 etc.).
7.12.25Improved command: 'StyleWin' can adapt YASARA's look to MacOSX 10.5 Leopard. Click Window > Style.
7.12.22Improved secondary structure assignment.
7.12.18Improved command: 'LoadPDB' supports a 'download' flag to automatically download missing PDB files.
7.12.5Fixed a problem with showing hydrogen bonds from version 7.11.25.
7.12.5Fixed an issue with the 'ShowPolygon' command, please update and add the polygons again.
7.12.4Fixed some Twinset issues in Windows Vista and a cygwin1.dll problem.
7.12.1Improved console: commands typed in can now be longer than the YASARA window.
7.11.28New command: 'ShowPolygon' draws a polygon connecting points or atoms. Read Commands > Effects > Polygons.
7.11.28New command: 'HidePolygon' hides a polgon connecting atoms.
7.11.27Fixed an issue in the attribute selection list.
7.11.26Improved Python interface: Selection can now be passed as Python lists [] to YASARA functions in Python modules and plugins.
7.11.25New feature: YASARA's treatment of hydrogen bonds has been reimplemented and accelerated, including angle dependence, more details at the ListHBo command.
7.11.23Improved command: 'Print' accepts an additional parameter 'Convert' to toggle the conversion of escape codes in strings.
7.11.22Improved command: 'ListHBo' also lists the energies of hydrogen bonds.
7.11.18Improved selection language: 'Ring' selects ring atoms, 'Aromatic' aromatic atoms.
7.11.16Improved selection language: 'BFactor','Property' and 'Occupancy' calculate averages over the current selection type.
7.11.14New highlight: YASARA can be used as a Python module, just 'import yasara'. Read Scripts > Use YASARA as a Python module.
7.11.10Improved typing of small molecules: 23 additional pitfalls are now considered.
7.11.3Improved selection windows: The 'Belongs to' list on the right side allows to select segments.
7.11.3New command: 'Seg' complements 'NameSeg' (which performs segment inflation now) and sets or gets segment names of selected units, which helps storing complex selections permanently. See also Selections > Yanaconda helps to define selection subsets.
7.11.2Improved consistency: ListObj also lists inactive objects.
7.10.29New support for NFS mounted multi-user YASARA installations. Read Essentials > Running YASARA in special environments > Running YASARA from an NFS mounted volume.
7.10.27New feature: when a simulation is switched off, YASARA wraps molecules that crossed a periodic boundary such that a maximum number of atoms are placed inside the cell.
7.10.26Improved command: MUSTANG based structural alignments using 'Align' have been speeded up by an order of magnitude in Windows.
7.10.18New guide and features for running YASARA on clusters: read Essentials > Running YASARA in special environments > Running YASARA on a cluster.
7.10.15Improved command: 'Align' accepts an additional parameter to help MUSTANG align difficult oligomers.
7.10.12New behavior: LoadSce now only sets surface parameters if a change of settings is requested with 'Settings=Yes'.
7.10.10Improved command: pKaRes can determine the pKas predicted during a neutralization experiment.
7.9.9New macro: md_runsteered.mcr runs a steered molecular dynamics simulations. More details in the documentation at Recipes > Run molecular dynamics simulations.
7.9.5Improved commands: 'SaveSim' and 'LoadSim' protect the simulation snapshots with a checksum to minimize problems with hard disk data corruption.
7.9.2New highlight: YASARA includes Arun S. Konagurthu's MUSTANG program to create pairwise and multiple structural alignments. Click Analyze > Align > Objects with MUSTANG.
7.8.28Improved command: 'Tabulate' can add strings to a table.
7.8.20New command: 'SaveAli' saves structural or sequence alignments in YASARA or FASTA format. Click Analyze > Align > Save alignment.
7.8.15New highlight: YASARA supports local Smith&Waterman and global Needleman&Wunsch sequence alignments. Click Analyze > Align.
7.8.10New command: 'AlignPar' sets various alignment parameters. Click Analyze > Align > Parameters.
7.8.5Fixed an issue with numerical molecular surfaces that occurred after changing the standard probe radius of 1.4 A.
7.7.31New highlight: The 'SupMulti' command superposes multiple objects together using the Theseus maximum likelihood approach developed by Douglas Theobald. This puts more emphasis on structurally conserved regions, allowing to superpose NMR bundles automatically without having to specify a target region. Click Analyze > Superpose > Multiple objects.
7.7.28Improved force field parameter assignment for 3- and 4-rings.
7.7.26New feature: The radii of sticks in balls&sticks and sticks alone can now be set independently. Click View > Stick > Parameters.
7.7.10Improved command: 'Clean' deletes water molecules that overlap with other atoms or each other.
7.7.4New feature: YASARA builds nucleic acids, DNA and RNA in all conformations. The 'BuildRes' command builds the first nucleotide, 'AddRes' appends at the 3' end, 'BuildMol' builds an entire nucleic acid based on a sequence.
7.7.3Improved commands: 'ShowTorus' and 'ShowSphere' support a new 'Alpha' parameter to create transparent objects. For 'ShowSphere', this change is not entirely backward compatible.
7.7.2Improved command: 'ListHBo' provides more intuitive output by listing atoms in the first selection that are hydrogen bonded with atoms in the second selection (i.e. bonds are listed in only one direction now).
7.7.1Improved Yanaconda macro language: the 'in' operator checks if a list contains a certain value, the priority of the bitlogical operators has been set higher than comparisons, just like in Python. The variables 'FirstObj' and 'LastObj' store the number of the first/last *active* object and -1 of no object is active.
7.6.29Improved commands: 'ListRes', 'ListMol', 'ListConRes', 'ListConMol', 'ListHBoRes' and 'ListHBoMol' now return unique residue and molecule ids instead of potentially ambiguous residue numbers and molecule names.
7.6.27Fixed selection inconsistency: DelAtom Occupancy<0.5 deletes all atoms with occupancy<50% (meant 0.5% before)
7.6.19New feature: Commands like 'SavePDB' now support the forthcoming new PDB format V3.0. Since it is less consistent and likely to cause problems with other programs, the original PDB format stays the default.
7.6.17New commands: 'AddPos' adds atom positions to an internal table, 'AveragePos' and 'RMSF' use these data to calculate average positions and root mean square fluctuations.
7.6.10Improved macro: 'md_analyze' calculates B-factors and the time-average structure from the simulation trajectory.
7.6.5Improved macro: 'md_analyzeres' also calculates per-residue fluctuations
7.5.30Improved command: 'SolvEnergy' is significantly faster, and the results have been optimized for accuracy.
7.5.20Improved command: 'Clean' deletes residues that overlap significantly with other residues and are most likely slightly different ligands bound to the same active site, like BTN/BTQ in 2F01.
7.5.14Improved command: 'Wait' can wait until the users marks an atom, distance, angle or dihedral.
7.5.11Improved command: 'MarkAtom' returns the numbers of the currently marked atoms.
7.5.8New command: 'CorrectConv' corrects errors in naming conventions (methylenes, Val/Leu side-chain flips) during a simulation to aid high-temperature NMR structure determination protocols. Click Simulation > Automatic correction of > wrong naming conventions (Dynamics+).
7.5.6Fixed a startup problem on some Mandrake/Mandriva Linux distributions.
7.5.5Improved command: 'BuildLoop' mutates all anchor residues if requested with 'Mutate=Yes'
7.5.4New feature: The 'Check' command performs a new 'NameConv' check of naming conventions (methylenes, Val/Leu side-chain flips) and also handles the checks for cis-peptide bonds and wrong isomers. The old commands 'CheckCis' and 'CheckIso' are now deprecated.
7.5.3Improved command: 'ShowHBo' supports a new 'Extend' flag to extend selections to hydrogen bonding partners, making it easy to show hydrogen bonds involving selected atoms. Click View > Show hydrogen bonds.
7.4.29New movie: Proteins for beginners, NMR structure determination, information content of NOE restraints, refining NMR structures and error detection by Sander Nabuurs, separate download from www.yasara.org/movies.
7.4.27Improved commands: 'Label' and 'Unlabel' can now also (un)label individual segments.
7.4.26New movie: Methionine synthase, example for visualizing enzymatic mechanisms with YASARA, by Richard Deth, separate download from www.yasara.org/movies.
7.4.24Improved command: 'Clean' renames left-over single OT1/OT2 atoms to O.
7.4.22New highlight: YASARA now features an accurate and fast, multi-threaded algorithm to calculate molecular surfaces in real-time including all cavities. Click View > Show surface > Parameters > Numeric.
7.4.18Improved feature: molecular surface calculations using the Gaussian approximation have been calibrated to reproduce the results of the new, more accurate molecular surface algorithm above.
7.4.16New macro: md_analyzesecstr creates a 3D plot and text table of the secondary structure changes during a simulation.
7.4.13Improved speed: YASARA is now compiled with a higher optimization level.
7.4.1New plugin: The ConSurf interface developed by Joost Van Durme and Sebastian Maurer-Stroh colors proteins by sequence conservation (using the ConSurf server by Landau et al.). Click View > Color > Molecule by ConSurf. The similar PDBFinderII color mapping has been moved to View > Color > Residue by feature.
7.3.30Improved surfaces: Calculations involving surface environments have been speeded up by 25%, surfaces also require significantly less memory.
7.3.28Improved command: 'Transfer' supports three different ways of handling local atom coordinates during an object transfer. When an object is transferred into the simulation cell, its CRYST1 record is set, so that the simulation cell can be saved in PDB files. Click Edit > Transfer.
7.3.21New feature: The 'SurfPar' command allows to choose between two sets of radii for molecular and solvent accessible surfaces. Standard VdW and more realistic effective solvation radii. Click View > Show surface > Parameters.
7.3.20Improved command: 'Dihedral' also sets and gets improper dihedrals if 'bound' is set to 'yes'.
7.3.15New workarounds for many bugs in Linux OpenGL drivers, especially for older video cards like e.g. Radeon 9X00, Intel integrated chipsets, Matrox G400.
7.3.11New highlight: YASARA has been ported to Mac OS X, including special support for Mac gadgets like the Mighty Mouse. Watch the help movie 'Working with YASARA' for details.
7.3.4New command: 'SeqSelector' toggles the display of the sequence selector at the bottom. Click Window > Show sequence.
7.2.26Improved support and workarounds for MESA indirect software rendering in Linux.
7.2.25Improved command: 'FramesPerSec' can also deactivate screen redraws when YASARA is idle to save CPU power. The SavePower command is deprecated.
7.2.24New feature: Hydrogens can be selected by their name according to many different nomenclatures. Read Selections > Additional selection types allow to filter for various properties > 'PDB', 'PDBRev'...
7.2.22Improved command: 'LoadPDB' corrects the hydrogen nomenclature unless 'Correct' is set to 'No'.
7.2.20Improved command: 'AddHyd' adds amide and guanidine hydrogens matching PDB naming conventions.
7.2.18New command: 'AtomSymbol' toggles the display of the chemical element symbol inside atoms that are cut open. Click Effects > Atom appearance > Element symbol.
7.2.15Improved command: 'Clean' swaps amide and guanidine hydrogens to match PDB naming conventions.
7.2.10Improved support for ATI Radeon cards in Linux: if driver >=8.X.Y is installed, graphics run significantly faster.
7.2.7New feature: Compressed files with '.Z' extension can now be loaded directly just like '.gz' files.
7.2.6Improved command: 'CD' allows to always change the working directory on startup, click Options > Change directory.
7.2.5New command: 'ShowButton Continue' shows a continue button and sets the Yanaconda variable 'ContinueButton' to true if pressed.
7.2.4Improved command: 'List' accepts a new 'Compress' parameter to return a compressed selection list, see Commands > Analyze > Scene content > List.
7.2.3New feature: The 'Charge' command has improved capabilities to not only set net charges but also individual atom charges. This change is not entirely backward compatible.
7.2.2Improved user interface: file selection menus provide various shortcuts to Home, Documents, Pictures etc.
7.2.1New command: 'Install' automatically installs POVRay or Python, click Help > Install program.
7.1.30Improved command: 'Raytrace' creates PNG images by default to save disk space.
7.1.28New feature: The neutralization experiment allows to request a certain NaCl contration and thus add more salt ions than needed to neutralize the cell (click Options > Experiment > Neutralization).
7.1.27Improved command: 'Mass' also lists the summed up mass.
7.1.26New command: 'ShowTorus' draws a ring-, horn- or spindle-torus. Click Effects > Show solid > Torus (Model+).
7.1.25Improved window manager: if all animations are disabled, clicks on icons and buttons now provide more visual feedback.
7.1.24Improved Yanaconda macro language: the 'rnd' function can randomize strings, e.g. to create random RGB colors.
7.1.17Improved command: 'JoinObj' can now also join polygon meshes like arrows, spheres, boxes etc.
7.1.14New feature: Dummy atoms (element 0) can now be included in a simulation without causing an error message.
7.1.11Fixed a YASARA for Windows issue where pulldown menus could not be closed after using the right mouse button to move a molecule behind an open window.
7.1.10Improved command: 'SavePower' now reduces YASARA's CPU requirements to truly 0 if no input is made. Click Window > Save power.
7.1.9Improved command: 'Wait' supports the new unit 'Femtoseconds' to make waiting during a simulation more straightforward.
7.1.7New highlight: YASARA's graphics engine now supports diffuse shadows and ambient lighting for balls to sticks, even on very old video cards. Watch the new help movie 'Lighting and shadows'.
7.1.6Improved commands: 'Sup' and 'RMSD' have improved flipping capabilities for equivalent atoms to minimize the RMSD: Hydrogens are now also considered and flipped atoms are listed in the console.
7.1.5Improved selection language: 'Segment' switches to a selection of macromolecular segments, read Selections > Additional selection types > Segment.
7.1.4New command: 'UndoLevels' sets the number of undo levels without having to edit yasara.ini. Click Options > Undo levels (Model+).
7.1.3Improved command: 'LoadPDB' allows to configure the path of a local PDB installation, click File > Load > PDB file from local PDB.
7.1.2Improved command: The 'Lightsource' command now also configures ambient lighting and shadows, the 'Shadow' command is deprecated.
7.1.1New highlight: YASARA now has a newly styled look, that also adapts to your current operating system, see www.yasara.org/looks. Click Window > Style (Model+).
6.12.31Improved commands: 'LoadSce' and 'SaveSce' now also load/save the projection, antialiasing, point & line appearance, fog and hbond colors, lighting parameters, surface parameters and cell boundary.
6.12.30Improved command: 'WinFont' now allows to choose between 6 different fonts, click Window > Font.
6.12.29Improved command: The 'HUD' command can show the head up display with an antialiased font, click Window > HUD > Antialiasing.
6.12.28Improved command: The 'ConsolePar' command can show the console with an antialiased font, click Window > Console > Parameters.
6.12.27Improved command: 'AnimateWin' command supports a new 'tilting' animation, click Window > Animation > Tilt.
6.12.26Improved plugins: The 'CheckBoxMenu' allows to set the default checkbox states by appending '(Checked)' to the box text.
6.12.19New feature: While a window is on screen (e.g. to interactively adjust dihedral angles), the scene can still be moved and rotated by holding down a mouse button outside the window.
6.12.17New feature: When specifying a macro as a command line argument, it is now possible to add variables, see Essentials > The command line parameters.
6.12.13Improved selection language: The 'with bond angles to' operator analyzes second neighbors in the molecule. Read Selections > Selections can be combined.. > The 'with <>X bond angles to' operator.
6.12.10Improved typing and force field parameter assignment for small molecules.
6.12.8Improved commands: Load* and Save* now support many more OpenBabel based fileformats.
6.12.3New highlight: The 'Processors' command activates support for multiple CPUs, heavily speeding up molecular simulations, see www.yasara.org/parallelmd and click Options > Processors (Dynamics+).
6.12.1Improved commands: 'Fix' and 'Free' are now included in the undo/redo history.
6.11.29New feature: Up to four bond lengths, bond angles and bond dihedrals can now be changed together interactively. Mark two atoms, then click Geometry > Bond .. in the atom context menu. For more details, check the 'Distance', 'Angle' and 'Dihedral' commands (Model+).
6.11.27Improved support for Windows Vista.
6.11.24Improved command: 'LoadPDB' accepts a 'Model' parameter to load only one model from an NMR bundle.
6.11.22New command: 'SwapBond' changes an existing bond order, the use of 'AddBond' for this purpose is deprecated. Click Edit > Swap > Bond.
6.11.21Improved Yanaconda macro language: the 'join' function concatenates a list to a single weak string.
6.11.20Improved selection language: the 'without contribution to .. surface' selects buried residues that do not contribute to a certain surface.
6.11.11New command: 'MoveMesh' moves a polygon mesh in the local coordinate system to facilitate rotations around certain points.
6.11.5New feature: YASARA's assembly language core now supports the SSE3 instruction set found in PentiumIV Prescott, Athlon64 Venice, Opteron 90nm and newer CPUs. On AMD Opteron, the speedup for MD simulations is ~10%. Make sure to either select 'Many' or a CPU architecture with SSE3 on the download page.
6.11.3Improved command: 'Temp' accepts a new 'reassign' parameter to toggle the reassignment of atom velocities according to a Maxwell-Boltzmann distribution.
6.11.1Improved command: 'LoadPDB' automatically adds missing CONECTs if the 'Correct' flag is set. Using LinkAtom is no longer needed.
6.10.30New example macro: md_refine.mcr refines a homology model and analyzes individual snapshots, check the docs at Recipes > Refine a homology model.
6.10.28Improved command: 'Link' does a better job ignoring bumps instead of assigning covalent bonds.
6.10.26Improved command: 'ListObj' now also lists those objects that do not contain atoms.
6.10.24New feature: The new parameter 'SetPar' of the 'ForceField' command allows to set optimal default simulation parameters, click Simulation > Force field (Dynamics+).
6.10.19Improved simulations: If the simulation cell includes only a small part of the protein, the simulation runs much faster now with (Y)AMBER force fields.
6.10.8New highlight: The 'Crystallize' command fills the unit cell with symmetry related copies of the selected object. Click Edit > Crystallize (Dynamics+).
6.10.4Improved macro language: the 'chr' function converts an ASCII number to a character string.
6.9.22New feature: Amino acid side-chains bound to ligands or metals are now shown when choosing one of the trace, ribbon or cartoon scene styles.
6.9.20Improved commands: 'LoadPDB' and 'SavePDB' preserve the crystallographic symmetry REMARK 290.
6.9.18New command: 'Compare' finds differences between atom and residue selections. Click Analyze > Compare.
6.8.19Improved command: 'NiceOri' can choose a nice orientation for the entire scene. Click Effects > Orientation > Set nicely for scene (Model+).
6.8.13Improved command: 'SwapRes' can swap nucleotides to Uridine and handle nucleotides like ATP or GDP.
6.8.6Improved command: 'BuildRes' supports a 'Center' flag to disable centering of the newly built residue.
6.8.1Improved command: 'SwapRes' keeps all useful side-chain dihedral angles to minimize reorientations (Model+).
6.7.25Improved command: 'RayTrace' supports a new 'Background' parameter to create transparent backgrounds.
6.7.15New highlight: The YAMBER3 force field provides another improvement in force field accuracy (Dynamics+).
6.7.10Improved command: 'SurfPar' can display the current surface parameters.
6.7.8Improved graphics: Lines are now drawn with antialiasing if requested (Window > Antialiasing) and supported by your OpenGL driver.
6.7.6Improved command: 'ColorPar' allows to choose all rainbow colors for the secondary structure elements. Click View > Color > Parameters > Secondary structure.
6.6.25Improved selection language: the 'with distance >X from' operators provide more intuitive results for 'Res', 'Mol' and 'Obj' selection types.
6.6.19New feature: MD simulations with solvents other than water are now much easier. Check the documentation of the commands 'FillCellObj' and 'PressureCtrl' (Dynamics+).
6.6.18New command: 'Mass' sums up atomic masses, click Analyze > Mass of.
6.6.17Improved command: FillCellObj allows to specify a density to easily fill the simulation cell with special solvents. Click Simulation > Fill cell with (Dynamics+).
6.6.16New command: 'SolvDensity' measures the density of any solvent, the 'WaterDensity' command is now deprecated.
6.6.12New feature: The current energies are displayed in the simulation HUD on the right side and can be quickly recalculated by pressing the key left to '1'.
6.6.11Improved commands: 'CorrectCis' and 'CorrectIso' can now also correct unusual amino acids.
6.6.10New feature: Having grabbed a single object for movement, it is now possible to grab the entire scene again by clicking a second time on the object name in the top right HUD.
6.6.9Improved commands: 'Sup' and 'RMSD' can now perform full matching of atom and residue names.
6.6.6New highlight: YASARA can now calculate force field energies individually for objects, molecules, residues and atoms. This makes it easy to localize regions of high-energy. Click Analyze > Energy (Dynamics+).
6.5.29New feature: The commands 'Sup' and 'RMSD' can now also shuffle atoms around within a residue to easily superpose molecules with different atom orders.
6.5.20New default: The 'CorrectCis' command does not correct cis-prolines by default now.
6.5.15Improved command: 'TransformObj' supports a flag to keep the global object position after transformation of atom coordinates. This is now the default.
6.5.7New command: 'RenumberObj' reorders the objects in the scene, helpful to close gaps in the HUD if objects have been deleted. Click Edit > Renumber > Objects.
6.4.30Improved command: 'Clean' adds cysteine bridges between close CYS SG atoms.
6.4.29New feature: Atoms causing an error message are now automatically highlighted.
6.4.28Improved command: 'LoadPDB' supports a 'correct' option to automatically delete unusually long CONECT bonds.
6.4.27Improved command: 'Clean' detects alternate conformations of entire molecules put on top of each other and deletes the one with the lower occupancy.
6.4.26Improved commands: 'LoadPDB' and 'Clean' detect and correct shifted atom names.
6.4.25Improved commands: Virtually all YASARA commands now support compression when reading or writing files whose names end with '.gz'.
6.4.23Improved commands: 'Sup' and 'RMSD' display a warning when trying to superpose atoms with different names.
6.4.21Improved plugin: The PDBFinder2 interface retrieves data from a new server and better handles proteins with chain-breaks. Click Analyze > PDBFinder2 properties.
6.4.15Improved command: 'Clean' sorts backbone and side-chain atoms within each residue.
6.4.9Improved commands: 'BuildRes', 'AddRes' and 'SwapRes' can now select specific Asp, Glu, His and Cys protonation states via special residue names.
6.4.8Improved command: 'Tabulate' now also adds string return values to a table, e.g. 'Tabulate NameRes all' tabulates all residue names.
6.4.7Improved command: 'Experiment minimization' checks for regions with strong bumps and performs a local steepest descent minimization without electrostatics first to avoid nuclear fusion caused by Coulomb attraction exceeding VdW repulsion.
6.4.5Improved command: 'Energy' explicitly returns a planarity energy also for the NOVA force field to identify severe planarity problems. Total NOVA energies therefore change a bit.
6.4.3New feature: YASARA now calculates solvent accessible surfaces using optimized 'effective' Van der Waals radii that implicitly consider hydrogen bonds. For best results, the probe radius should be set to 1.4 A (click View > Show surface > Parameters).
6.3.27Improved command: 'List' supports a new 'Format' parameter to also get names in specific formats, not only numbers.
6.3.26New commands: 'PosMol' and 'PosRes' set and get the position of the geometric center of molecules and residues, click Effects > Position.
6.3.25Improved command: 'SecStrRes' returns the secondary structure as a list of character strings 'H','E','T' and 'C'. Numerical codes are deprecated.
6.3.24New highlight: the commands 'GroupDistance', 'GroupAngle' and 'GroupDihedral' calculate the distance between geometric centers and the angles between lines and planes optimally fit through groups of atoms, e.g. the angles between two helices or phenyl rings. Click Analyze > Geometry (Model+).
6.3.23Improved command: 'SaveMOL2' stays closer to the file format when saving proteins.
6.3.20New feature: The 'Surf' command supports a new 'unit' parameter to calculate surface areas per molecule, residue or atom.
6.3.16Improved command: 'Color' accepts multiple sequence alignment also in FASTA format when coloring by sequence conservation.
6.2.12New command: 'Name' sets or gets the names of objects, molecules, residues and atoms. The 'Rename' command is now deprecated.
6.2.10New command: 'UnlabelDis' deletes distance labels between selected atoms. Click Effects > Unlabel > Distance.
6.2.7New workaround for flickering problems on Intel GMA 9xx graphics chips when running YASARA fullscreen.
6.2.5Improved command: When 'Raytrace'ing with outlines, black labels are excluded to allow proper labelling of schematic figures.
6.1.24Improved bond typing: A weighted average of bond length and bond angle deviations is now used to determine hybridization states.
6.1.23Improved command: 'SwapAtom' knows all standard (order dependent) bond lengths between organic elements and updates them accordingly.
6.1.22New feature: 'Check WaterPos' calculates normality Z-scores for water molecules to identify those at unlikely positions, e.g. a hydrophobic protein cavity. Click Analyze > Check (Dynamics+).
6.1.19Improved command: 'Experiment Neutralize' uses an improved algorithm to avoid placing water molecules in cavities where a vacuum would be energetically more favorable.
6.1.17Improved macro language: the 'dirname' function extracts the directory name from a string.
6.1.15New improved algorithm to remove center-of-mass-motion from a simulation, solutes are now less likely to pass periodic boundaries, which makes visualization easier (Dynamics+).
6.1.14Improved command: 'Sim Pause' can now be used to pause a simulation after a given time. Click Simulation > Simulator > Pause in...
6.1.13Improved commands: 'Label' and 'Unlabel' are now restricted to create and delete labels of a given unit type. Click 'Effects > Unlabel > All above' to delete all labels at once.
6.1.12Improved commands: 'Sup' and 'RMSD' can determine the chemical equivalence of molecules with exotic atoms to minimize the RMSD via the 'flip' flag.
6.1.11Improved command: 'ForceField' allows to set the charge assignment scheme: AutoSMILES, AM1BCC or AM1 (for comparison and validation only).
6.1.10New feature: The 'AutoSMILES' algorithm automatically splits long aliphatic lipids that contain too many atoms for QM charge derivation (Dynamics+).
6.1.9Improved command: 'Clean' makes external single atoms bound to a residue part of this residue, e.g. three oxygens bound to Cys SG atoms.
6.1.8Improved command: 'Experiment' automatically cleans the soup in case hydrogens are missing, 'Neutralization' does a better job removing waters from the protein core.
6.1.7Improved command: 'Clean' deletes terminal residues with incomplete backbone, which are usually X-ray artifacts.
6.1.6Improved feature: automatic force field parameter assignment and QM optimization in water are now 6x faster in YASARA for Windows.
6.1.1New highlight: The 'AutoSMILES' algorithm fully automatically parameterizes organic molecules for simulation, including assignment of point charges by combining the high-throughput AM1BCC approach with a large SMILES-based library of optimal RESP charges, making it possible to run MD simulations of most PDB files at the touch of a button. Read www.yasara.org/autosmiles or Recipes > Running molecular dynamics simulations > Preparing the force field > Deriving new (Y)AMBER parameters (Dynamics+).
5.12.31Improved typing of double bonds outside rings.
5.12.30Improved selection language: the 'Charge' operator allows to select by net charge. Look at the end of the 'Belongs to or has' list or read Selections > Additional selection types > Charge.
5.12.29New help movie: 'Simulation and quantum mechanics of small molecules' introduces fractional bond orders and pH dependency, shows how to build and simulate small molecules, and how to use quantum mechanics to optimize geometries and compare tautomers. Click Help > Play help movie > Simulation and QM of small molecules. (Dynamics+)
5.12.28Improved command: 'LabelDis' accepts a new 'bound flag' to label only distances between bound atoms.
5.12.27New highlight: The 'QuantumMechanics' command activates the semi-empirical MNDO, AM1 or PM3 quantum chemistry methods provided by the built-in YAPAC, a customized and validated derivative of MOPAC. Click Options > Quantum mechanics (Dynamics+).
5.12.26Improved command: 'Label' supports two new format options 'ATOMTYPE' and 'ATOMCHARGE' to label with atom type and charge respectively.
5.12.25New feature: 'pH' sets the implicit solvent model used in quantum chemistry calculations, either none when working in vacuo or COSMO by A.Klamt when working in solution.
5.12.24Improved command: 'Sim Init' automatically adds springs to enforce virtual bonds to metal ions (i.e. headless arrows added by ShowArrow or by CONECT records in the original PDB file) (Dynamics+).
5.12.23New highlight: The 'Optimize' command tunes the geometry of molecules containing up to ~100 atoms using semi-empirical quantum chemistry. Click Edit > Optimize.
5.12.22Improved command: 'AddBond' accepts a new 'bound flag' to modify only existing bonds. Click Edit > Add > Bond.
5.12.21New command: 'FormEnergy' calculates the heat of formation using semi-empirical quantum chemistry. Click Analyze > Energy > Formation.
5.12.20Improved command: 'AutoMoveImage' supports two ways of repeating the automatic image movement: 'Cycle=MoveBack' and 'Cycle=JumpBack'.
5.12.19New command: 'TypeAtom' retrieves the currently assigned force field atom types, for example to label atoms accordingly.
5.12.18Improved command: When importing molecules with OpenBabel using 'Load*', the 'Resonate' flag allows to automatically replace alternating single/double bonds with the proper resonance form.
5.12.16Improved command: 'Clean' replaces seleno-methionine with methionine and deletes NMR dummy atoms (element 0).
5.12.15New highlight: The new General AMBER Force Field (GAFF) provides force field parameters for any organic molecule.
5.12.14Improved typing of bonds and handling of alternate atoms.
5.12.10New WHAT IF released as part of the Twinset. WHAT IF's homology modeling module now also works in the Twinset.
5.12.7Improved handling of cyclic peptides: Traces, tubes and ribbons are now drawn without a gap, provided that the cyclic peptide bond is indicated with a 'CONECT' in the PDB file.
5.12.3New command: 'KekulizeBond' converts resonance bonds with fractional bond orders to alternating single/double bonds. Click Edit > Adjust bond orders > Kekulize bond.
5.12.2Improved command: 'RMSD' accepts a 'flip' flag like 'Sup' to minimize the calculated RMSD by flipping chemically equivalent atoms.
5.12.1New command: 'ResonateBond' converts alternating single/double bonds to the proper resonance form. Click Edit > Adjust bond orders > Resonate bond.
5.11.26Improved command: 'ShowTrace' displays a trace also for Calpha only proteins when you press <F4>.
5.11.25Improved command: 'Clean' detects residues with missing bonds and invokes 'Link' to find them before adding hydrogens.
5.11.24Improved command: 'LoadPDB' automatically searches and types links in standard residues with non-standard atom names.
5.11.23New workaround for a new ATI Radeon OpenGL Linux driver bug (missing secondary structure), updated installation hints at Troubleshooting > YASARA runs slowly > You are running Linux with an ATI Radeon.
5.11.22Improved command: 'Link' uses a new algorithm to find also large numbers of bonds quickly.
5.11.20Improved command: The tubes and ribbon created by 'ShowSecStr' stay correct when the protein crosses a periodic boundary.
5.11.19Improved command: 'PosAtom' can now set and get the mean position of an atom selection.
5.11.18New highlight: The improved 'TypeBond' command employs a new algorithm combining graph theory with chemical knowledge on valence ambiguities and preferred tautomers to type complicated hetero-polycycles, e.g. in PDB file ligands. See www.yasara.org/typing or click Edit > Type bonds.
5.11.14Improved command: 'LoadPDB' provides special support for ancient but still official PDB files with weird atom names.
5.11.10Improved plugin: the OpenOffice Impress import filter now supports OpenOffice 2.0. Click Options > Macro & movie > Import movie
5.11.6New Yanaconda function: 'ord' returns the summed ASCII code of the given string
5.11.4Improved command: 'Dihedral' can now change improper dihedrals, also interactively from the atom context menu.
5.11.3New command: 'Dipole' calculates the electric dipole moment. Click Analyze > Dipole moment of (Dynamics+).
5.11.2Improved selection language: the operator 'within sequence' selects units belonging to a given sequence, e.g. ColorRes Lys within sequence Arg Lys Phe,yellow.
5.11.1New workaround for a Mandriva Linux 2006 AMD64 problem, which is lacking the library 'libncurses'.
5.10.15Improved selection language: Single or double quotes can be used to span unusual atom/residue/object names with special characters like spaces.
5.10.9New highlight: Structural alignments using the CE, Multiprot and Sheba methods are available for Windows and Linux thanks to a plugin and webserver developed by Emmanuel Bettler and Mikael Roche. Click Analyze > Align.
5.10.8Improved command: 'BuildAtom' allows to define the position of the new atom, which helps to place dummy atoms e.g. in the center of a phenly ring to measure distances.
5.10.7New command: 'pKaRes' assigns pKa values to selected residues that override the predictions made during the neutralization experiment. Click Options > Residue pKa.
5.10.5Improved command: 'SwapRes' can swap residues to Uracil and keeps the chi1 dihedral intact.
5.10.1New highlight: The commands 'ShowSphere', 'ShowBox' and 'ShowCone' display solid spheres, ellipsoids, cubes, boxes, cylinders, cones, prisms and pyramids. Click Effects > Show solid. Click Help > Play help movie > 'Buckynut Island' for a demonstration (Model+, download from www.yasara.org/movies in YASARA View).
5.9.25New Yanaconda function: 'trunc' returns the integer part of a number, rounded towards zero.
5.9.18New command: 'MoveMesh' translates a polygon mesh in its local coordinate system to allow off-center rotations. Click Effects > Move > Mesh.
5.9.15New command: 'SearchDoc' googles the YASARA documentation. Click Help > Search documentation.
5.9.10Improved command: 'Experiment Neutralize' does a better job at keeping original water molecules very close to metal ions instead of replacing them with newly added ones.
5.9.6Improved command: 'Link' now uses the atomic bond radii and an 'allowed deviation' parameter to find bonds. The bond orders are also assigned automatically.
5.9.2New highlight: The 'pH' command sets the default pH, YASARA now has extensive knowledge about pH dependent bond orders and protonation patters of organic molecules and assigns bond orders and hydrogen atoms according to the chosen pH. Read Commands > Options > Default pH (Model+).
5.8.30Improved command: 'SampleLoop' allows to select the preferred secondary structure.
5.8.24Improved command: 'LoadPDB' automatically topologyfies ligands in PDB files and assigns bond orders.
5.8.21New highlight: The 'TypeBond' command analyzes any organic molecule and assigns fractional bond orders, making it easy to add hydrogen atoms. It is no longer required to manually add topologies for unknown molecules to yasara.def. Read Commands > Edit > Bonds > TypeBonds.
5.8.19Improved command: 'AddHyd' contains a new 'update' parameter to adjust bond orders to the newly added hydrogens.
5.8.15New feature: Bonds to metals (which are not considered real bonds by MD force fields) are converted to virtual bonds and shown as cylinders when reading/writing PDB files. Read Commands > Edit > Bonds > AddBond.
5.8.10Improved command: 'AddBond' now accepts fractional bond orders to express resonance effects and a parameter to update hydrogens. Read Commands > Edit > Bonds > AddBond.
5.8.2New highlight: The PovRay interface has been heavily improved and now includes fog, textures (MakeImageObj), fore- and background images (ShowImage), exact background colors and the ability to add outlines for comic style graphics. Read Commands > File > Screenshots > Raytrace.
5.8.1Improved command: 'Color' accepts RGB atom colors and finds the closest matching color in YASARA's own color scheme.
5.7.30New command: 'SaveMacro' creates a macro that restores selected parts of YASARA's current state: scene, visualization parameters, images, simulation parameters, window parameters. Click Options > Macro & Movie > Save macro.
5.7.29Improved command: 'PressCtrl' can exclude axes from rescaling.
5.7.28New highlight: The 'Projection' command toggles between perspective and parallel projection. Click View > Projection.
5.7.21Improved command: 'RayTrace' and 'SavePOV' now also include the black outline of the comic atom texture (View > Atom appearance > Texture > Comic).
5.7.20Improved command: 'AddHyd' automatically corrects bond orders and atom names of carboxyl groups.
5.7.19Improved command: 'SaveXTC' and 'LoadXTC' have improved LFS support to handle trajectories larger than 2 GB in Linux.
5.7.18New highlight: A new plugin automatically converts OpenOffice/PowerPoint presentations to YASARA movies, which makes it easy to augment them with hi-quality molecular animations. Read Recipes > Create your own YASARA movies > Movies can be imported from OpenOffice and PowerPoint (Model+).
5.7.17Improved command: 'Clean' corrects bond orders and atom names of carboxyl groups.
5.6.30Improved command: 'AddBond' now gained the 'UpdateHyd' option to suppress the update of hydrogen atoms.
5.6.29Improved plugins: Error reports and update requests now function without having to add an email server in plg/reporter.cnf
5.6.23Improved command: 'ScaleForce Planarity' now includes not only improper dihedrals, but also normal dihedrals in planar systems.
5.6.21Improved multi-monitor support: Set 'CorrectWin' in yasara.ini to 0 to disable the window size correction, which helps if the YASARA window is on monitor 2.
5.6.16Improved command: 'WaterDensity' works better in non-periodic cells, where the vacuum layer between cell wall and atoms (caused by repulsive wall forces) is now excluded from the density calculation.
5.6.14Improved command: 'PressureCtrl' now rescales only the simulation cell and not the atom coordinates if there are atoms outside a non-periodic cell.
5.5.25Improved command: 'BuildMol' now also reads FASTA sequences to build a linear peptide chain (Model+).
5.5.22New highlight: The 'Volume' command calculates VdW, molecular and solvent accessible volumes. Click Analyze > Volume of (Model+).
5.5.20New command: 'ScaleForce' scales bond, angle, dihedral, planarity and non-bonded forces during a simulation. Click Simulation > Scale forces. The commands ScaleBSFC and ScaleNBI are now deprecated (Dynamics+).
5.5.18New feature: Yanaconda macros can contain 'include' statements to include other macros (read Macros > Yanaconda macros can include each other).
5.5.16Improved commands: 'CorrectIso' and 'CorrectCis' use a new dihedral-angle based algorithm to enforce correct stereochemistry during high temperature simulations.
5.5.13New command: 'NiceOri' orients an object nicely (along its major axes). Click Effects > Orientation > Set nicely for object (Model+).
5.5.12Improved command: 'CorrectCis' allows to exclude proline residues from cis-peptide bond correction.
5.5.9Improved command: 'Clean' swaps methylene hydogens to match PDB/XPLOR conventions for stereoassigned NOEs.
5.5.1Improved force field parameter assignment for DNA/RNA bases.
5.4.5New IMPORTANT feature: YASARA's internal force field representation has been changed. If you modified force fields, recompile them with 'yasara -upd' now.
5.3.31Improved command: OpenBabel export with 'Save*' now offers a 'transform' option to restore original atom coordinates and a 'nameformat' option to choose among different atom naming conventions. A few OpenBabel for Windows issues have been fixed.
5.3.30New feature: the order of covalent bonds can be shown in Ball&Stick style with 'ColorBonds Order'.
5.3.28Improved command: 'SavePDB' allows to select the YASARA PDB format variant in addition to PDB standard and Xplor.
5.3.20New IMPORTANT feature: The conventions for triclinic (=non-rectangular) simulation cells have been changed to match the PDB format. .sce or .sim files with non-rectangular cells have to be converted. Please update YASARA Dynamics (as a bonus, the PME code runs a bit faster now).
5.2.28Improved detection of unusual DNA/RNA bases to display them as part of the DNA/RNA backbone.
5.2.26New command: 'SecStr' assigns a custom secondary structure and analyzes the secondary structure content. The commands 'ShowSec' and 'HideSec' changed their names to 'ShowSecStr' and 'HideSecStr'. Click Analyze > Secondary structure of.
5.2.24New feature: OpenBabel has been updated to version 1.100.2, the command 'Save*' now also exports atom charges assigned by the current force field. Click File > Save as > Other fileformat.
5.2.17Improved command: If there are residues with alternate locations, 'Clean' keeps only the one with highest occupancy.
5.2.13New highlight: The 'Check' command performs 20+ different WHAT_CHECKs of protein structures: bonds, angles, torsions, omega angle, Ramachandran plot, side-chain rotamers, proline rings, chirality, planarity, backbone conformation, peptide-plane flips, bumps, 3D packing quality, inside-outside distribution, unsatisfied H-bonds, flipped Asn/Gln/His side-chains, B-factors and atom occupancies. Click Analyze > Check (Twinset).
5.2.11New command: 'PointPar' sets the style and thickness of point/wireframe objects (ShowESP,ShowSimGrid,WHAT IF MolObjects). Click View > Point & line appearance.
5.2.9New highlight: The 'Align' command performs a structural alignment with the MOTIF algorithm. Click Analyze > Align (Twinset).
5.2.7Improved command: 'LoadPDB' now searches a local PDB automatically if 'PDBPath' is defined in yasara.ini
5.2.5New highlight: The 'OptHyd' command optimizes the hydrogen bonding network and flips Asn/Gln/His side-chains if that improves the network. Click Edit > Add > hydrogens to: object & optimize (Twinset).
5.2.3Improved command: 'SaveMPG' now uses a quality instead of bitrate setting, which avoids encoding failures with some animations.
5.2.1New highlight: The 'Regularize' command optimizes bond lengths, angles and chirality. Click Edit > Geometry > Regularize (Twinset).
5.1.30Improved commands: 'Raytrace' and 'SavePOV' now also work in console mode, e.g. on a web-server creating molecular graphics with YASARA.
5.1.28New highlight: The 'ShowRota' command shows the backbone dependent rotamer distribution for selected residues. Click Analyze > Rotamers (Twinset).
5.1.21Improved command: 'ScreenSize' also works in console mode and defines the aspect ratio of ray-traced output.
5.1.20Improved selection language: the 'Property' operator selects atoms by their property value.
5.1.19Improved command: 'ColorPar' can change the default color range for atom properties.
5.1.18New command: 'Prop' gets and sets the new atomic property value that maps to WHAT IF's 'atomic value' and becomes very helpful in the Twinset.
5.1.17Improved command: 'PosAtom' now also gets/sets atom positions in the global coordinate system.
5.1.12Improved command: 'SaveXTC' wraps molecules around periodic boundaries to avoid saving 'broken' ones with bonds that span the simulation cell.
5.1.11Improved command: 'TransferObj' can now also correctly transfer static surfaces and similar geometry to another coordinate system.
5.1.10Improved commands: 'LoadSim' and 'LoadXTC' now have an option to disable secondary structure reassignment.
5.1.9Improved commands: 'RayTrace' and 'SaveMPG' allow to disable the PovRay window.
5.1.5New highlight: The 'SaveMPG' command creates MPEG movies, plain or ray-traced. Click File > Save as > MPEG movie (Model+).
4.12.31Improved support for resolution independent movies. See Recipes > Create movies > The look of the movie.
4.12.29Improved command: 'LoadXTC' applies the transformation history of the target object to avoid unwanted shifts.
4.12.25New highlight: The 'SolvEnergy' command calculates solvation energies using a fast boundary element approach. Click Analyze > Energy > Solvation (Dynamics+).
4.12.19Improved commands: 'AddHyd' and 'Clean' make better choices when inventing hydrogen names.
4.12.17Improved command: 'Label' supports new format components: OBJNAME,OBJNUM,ATOMNAME and ATOMNUM. Click Effects > Label.
4.12.15New highlight: YASARA now supports copy&paste, the console at the bottom has been heavily improved with history and selections. Click Essentials > The keys and mouse buttons > Using the console.
4.12.13Improved commands: 'ListCon' and 'ListHBo' now also return the selected units, e.g. atomlist()=ListConAtom Mol A,Mol B.
4.12.11New command: ConsolePar changes the size and font of the extended console (press <Space> twice to bring it up). Click Window > Console > Parameters.
4.12.9Improved selection operators: 'with distance' and 'with atoms among' now consider periodic boundaries during a simulation.
4.12.7Improved command: 'Experiment Neutralization' does a better job at reaching the requested water density.
4.11.30Improved secondary structure assignment for double beta bulges.
4.11.29Improved support for hires notebook screens up to 1680x1050.
4.11.24New feature: hydrogen bonds can now inherit the color of the bound atoms, click View > Color > Hydrogen bonds.
4.11.23Improved quad-buffered stereo and ray-tracing of stereo images.
4.11.14New command: 'FlipTab' flips a pair of table axes (columns, rows, pages). Click Options > Tables > Flip.
4.11.13New feature: YASARA can now work with 250 objects at the same time (Model+)
4.11.12Improved commands: 'Sup' and 'RMSD' calculate all permutations if several objects are selected and support a 'unit' parameter. Averages and standard deviations are no longer returned.
4.11.11New Yanaconda functions: 'mean' and 'stddev' calculate the average and standard deviation of a list.
4.11.10Improved command: 'Center' now also allows to center on atoms, residues and molecules. E.g. click Center > Atom in the atom context menu.
4.11.9New highlight: Tables have been reimplemented and heavily improved. They can now be one-, two- or three-dimensional. The 'ShowTab' command visualizes tables using various styles. Click Options > Table > Show.
4.11.8New command: 'MakeTab' creates a new table with one to three dimensions. Click Options > Table > Make.
4.11.7New command: 'DelTab' deletes tables. Click Options > Table > Delete.
4.11.7New command: 'Tab' sets or gets table cells, columns, rows, pages and entire tables. Click Options > Table > Set/get cells.
4.11.6New command: 'Tabulate' adds new cells to a growing table and replaces the deprecated 'AddTab' command.
4.11.6New command: 'SelectTab' selects a table for use by the new 'Tabulate' command. Click Options > Table > Tabulate.
4.11.5New command: 'LoadTab' loads a table in plain text format from disk. Click Options > Table > Load.
4.11.5Improved command: SaveTab allows to select a table, which supports the forthcoming release of heavily improved tables. This is one of the rare changes that are not backwards compatible but required for consistency.
4.11.4Improved plugin: Emmanuel Bettler added an option to check for YASARA updates. Click Help > Check for update.
4.11.3Improved command: 'Link' now also assigns the order of covalent bonds for residues with topology information in yasara.def.
4.11.1Improved command: 'FillCellObj' allows to define the maximum allowed sum of bumps.
4.10.31New Yanaconda functions: 'sum' and 'average' sum up list elements and calculate the average.
4.10.30Improved windows: all load/save dialogs have been enlarged so that long filenames are easier to read.
4.10.29New command: 'Radius' calculates Van der Waals radii. Click Analyze > Radius of.
4.10.28Improved commands: 'Occup' and 'BFactor' now allow to set unusual atom occupancies and B-factors from -99.99 to 999.99 for programs that expect different data like charges and radii in these columns of the PDB file.
4.10.24New feature: YASARA now reads gzip compressed files (.gz extension) transparently. Time to compress your local copy of the PDB?
4.10.21New command: 'MouseWheel' assigns one of four functions to the mouse wheel. Click Window > Mouse wheel command.
4.10.20New command: 'SavePower' enters a special power saving mode for notebooks running on battery. Click Window > Save power.
4.10.19New command: 'WinFont' changes the fonts used by YASARA's window manager. Click Window > Font.
4.10.16New highlight: The 'FirstSurf' command combined with the new selection operators 'with distance from surface' and 'with contribution to surface' enables very flexible surface analysis. See Commands > Analyze > Surfaces > FirstSurf (Model+).
4.10.15Improved command: 'Color' now returns the colors of the selected atoms: collist() = ColorAtom Obj 1crn
4.10.14New Yanaconda feature: You can now loop over the content of a file, e.g. a list of PDB IDs: for id in file /home/id.txt, see Macros > There a four types of loops > Loops can run over a list.
4.10.13Improved secondary structure assignment for some beta bulges.
4.10.4New feature: 'yasara -txt' runs the program in plain text mode, see Essentials > Running YASARA in special environments > Running without graphics.
4.10.3New movie available: 'PhD defence', a summary about the technology and science behind YASARA at www.yasara.org/multimedia.
4.10.2Improved filename handling: loading a file with missing extension is now possible, and the working directory is searched before any subdirectories.
4.10.1New feature: The mouse wheel scrolls through lists and selects the previous and next atoms.
4.8.31Improved command: 'AddSpring' can now add springs to atoms without intramolecular interactions (ions).
4.8.27Improved selection language: 'LocalX|Y|Z' and 'GlobalX|Y|Z' allow to select atoms by their positions. Selections by 'BFactor' and 'Occupancy' are now also possible.
4.8.26New highlight: Emmanuel Bettler contributed a Linux plugin to create MPEG movies and animated GIFs. Click File > Save as > MPEG/GIF movie.
4.8.24Improved command: 'SwapRes' can now also swap non-standard amino acids like seleno-methionine.
4.8.22New highlight: Mikael Roche & Emmanuel Bettler developed a structural alignment plugin using SHEBA (by J.Jung & B.Lee). Click Analyze > Superpose > Objects automatically (Linux only).
4.8.18New command: 'ColorPar' sets various default color schemes for chemical elements, secondary structure, B-factors. Click View > Color > Parameters.
4.8.18Improved command: 'Zoom' now also considers the visibility of surfaces when fitting atoms on the screen and is much faster for large proteins.
4.8.17Improved command: 'RayTrace' does a better job putting special textures (selected with 'AtomTexture') on the atoms
4.8.13New command: 'PrintHUD' allows plugins to print to YASARA's head-up-display and is now also available in YASARA View.
4.8.13New highlight: Several improvements make building small molecules very easy. Get an update and watch the new help movie 'Building small molecules' (Model+).
4.8.12Improved command: 'AddBond' now automatically adapts the hydrogen atoms (if the object contains any) to the new bond order.
4.8.8New feature: Python plugins can be run directly from the command line: yasara MyPlugin.py MyRequest ('MyRequest' is sent to the plugin, no selections are available).
4.8.8Improved plugin: The PDBFinder2 plugin to analyze proteins now uses the BioASP server at www.bioasp.nl
4.8.6New command: 'AddHydAtom' allows to add hydrogens to individual atoms, e.g. to quickly force Histidine protonation.
4.8.3Improved command: 'AddHyd' is orders of magnitude faster now and places aliphatic hydrogens more intelligently.
4.7.21Improved command: 'FillCellWater' and 'Experiment Neutralize' are now less likely to place waters inside homology models with a loose core packing. The second parameter had to be changed. Post-processing steps to delete these waters are not absolutely required anymore.
4.7.18New Python plugin command: yasara.Finish() synchronizes the plugin with YASARA, more info at Plugins > Python plugins run in a separate thread
4.7.10Improved sequence selector: atoms behind it are clickable while the sequence selector is transparent.
4.7.4New highlight: A 'neutralizing plasma' allows to run Particle Mesh Ewald simulations also with non-neutral simulation cells. Simulation algorithms and energy calculations have been improved and run a bit faster now. Update now!
4.7.3Improved command: 'Surf' calculates surface areas 0.1% more accurately.
4.6.25Renumbering residues is now restricted to the 'RenumberRes' command. To renumber the residues in object 1crn, type 'RenumberRes Obj 1crn'. The shortcut 'RenumberObj 1crn' is deprecated.
4.6.18New movie feature: When a movie ends (or you click on Options > Macro & Movie > Stop), the scene including background colors+working directory is restored. To avoid that, run the movie as a macro.
4.6.17New command: 'ShowCom' opens the documentation for a given command in the browser.
4.6.16Improved command: The default Calpha color 'cyan' is now passed on to the ribbon/tubes/cartoons if all backbone atoms are cyan, not only if all residue atoms are cyan.
4.6.15New command: 'ShowDoc' opens the documentation in a browser window.
4.6.14Improved commands: During a simulation, static surface objects ('ShowSurf') and calculated surface areas ('Surf') consider all objects simultaneously.
4.6.7Improved command: 'CenterAll' centers all objects together, which keeps the superposition intact after loading multiple PDB files with centering disabled.
4.6.5Improved command: 'LoadPDB' handles incorrect/single-sided CONECT records.
4.6.1Improved commands: 'AddHyd' and 'Clean' now do a better job when working with alternate atoms and Val/Leu residues with swapped CG/CD atom names.
4.5.20New highlight: Support for Spaceball 3D input devices has been added (Linux only for now). Click Window > Spaceball to adjust the settings (Model+).
4.5.19New commands: 'GrabNext' and 'GrabPrev' grab the next and previous object for movement with mouse or SpaceBall. Helpful when assigned to SpaceBall buttons (Model+).
4.5.18Improved command: 'Clean' now automatically deletes bonds to cations, which may not be present during simulations.
4.5.17New optimized algorithms for several tasks that became bottle-necks when working with giant structures (300000 atoms). Many things run 100x faster now. See also the hints at Essentials > Working with extremely large structures.
4.5.12Improved support for NFS mounted multi-user installations: In the docs, click Essentials > Running YASARA in special environments.
4.5.12New release of the YASARA Models@Home distributed computing system with support for Redhat 9, Fedora Core, Mandrake 9, Windows XP.
4.5.11New highlight: Three new surface movies available from www.yasara.org/movies: Introduction, Environments and Electrostatics.
4.5.11Improved command: 'CountObj' now counts all objects, not just those with atoms.
4.5.10New highlight: The 'ShowSurf' command shows Van der Waals, molecular and solvent accessible surfaces, either static or dynamically updated.
4.5.9Improved command: 'MarkAtom' can now mark up to four atoms.
4.5.8New highlight: The 'ColorSurf' command assigns surface colors and transparency, options include coloring by atom and electrostatic potential.
4.5.7Improved selection language: 'with <>X bonds to' allows to select by the number of bound atoms.
4.5.6New highlight: The 'SurfPar' command sets the surface resolution and activates an interface to Michel Sanner's MSMS program which calculates analytic molecular surfaces.
4.5.4New highlight: The 'Surf' command allows to calculate VdW, molecular and solvent accessible surface areas (YASARA Model+).
4.5.3Improved handling of unusual amino acids: even those forgotten in the official PDB hetgroup dictionary are recognized correctly.
4.5.3New highlight: The 'AddEnv' and 'RemoveEnv' commands allow to define surface environments to analyze partial surfaces (YASARA Model+).
4.5.2Improved experiment: 'Experiment Minimization' converges faster now.
4.5.1Improved selection language: 'visible' and '!visible' allow to select (in)visible atoms.
4.4.30New Yanaconda operator: Like in Python, '//' performs a division with truncation of the result's fractional part, e.g. 3//2 = 0
4.4.29Improved logs: Specifying a filename with .log extension as a command line argument will automatically record a log.
4.4.28Improved command: Logs recorded with 'RecordLog' are now flushed continuously and do not lag behind.
4.4.25New Yanaconda function: 'onein' returns a random list element.
4.4.15Improved command: 'Clear' now also clears the 'Tabulate'/'SaveTab' table. Use 'Del' instead of 'Clear' when adding values to a table.
4.4.14Improved command: 'Tabulate' now accepts an arbitrary number of values to add to a table.
4.4.12New command: 'SpeedUp' allows to toggle the speedup of movements when graphics are slow
4.4.9Improved documentation: Click Commands > Index to get an alphabetic list of all YASARA commands
4.4.7Improved installation: In Linux, you can now install YASARA as user A (e.g. 'root') and then work as user 'B' as long as you run it once as user 'A'.
4.4.3Improved Yanaconda macro language: up to 1000 times faster (better list handling, reduced printout in the console)
4.4.3Improved command: 'AddObj' returns the numbers of the first and last atom in the newly added object, e.g. first,last=AddObj 7
4.4.2Improved command: 'SplitObj' and 'OligomerizeObj' return a list of created objects, e.g. objlist()=SplitObj 5
4.4.2New Yanaconda feature: iterate over a list, e.g. selection()=ListAtom CA / for atom in selection
4.4.1Improved command: 'ListAtom' and 'ListObj' return a list of atom and object numbers.
4.4.1New Yanaconda feature: Assign the return values of YASARA commands to a list, e.g. mylist()=ListAtom CA
4.4.1Improved command: 'MakeImageObj' returns the number of the created image.
4.3.26Improved help movies: the 'OnError Continue' command makes sure that they will not stop if you make an error.
4.3.16New ATI Radeon Linux HOWTO (click Troubleshooting>YASARA runs slowly), workaround for a Radeon Linux driver bug in 'ShowMessage'.
4.3.14New highlight: A plugin for Bert de Groot's CONCOORD program allows to quickly sample conformational space and analyze protein flexibility. Click Edit > Sample.
4.3.14New Yanaconda functions: 'min MyList' and 'max MyList' return the smallest and largest list element.
4.3.13Improved command: 'Span' can now also determine the first and last residue number in a selection
4.3.13New command: 'BFactor' gets and sets the BFactor.
4.3.13Improved command: 'Temp' now also returns the current simulation temperature (YASARA Dynamics+)
4.3.12New command: 'Charge' gets and sets the net charge. The old command 'NetCharge' is now deprectated (YASARA Dynamics+)
4.3.12Improved command: 'Color' can now color by atom occupancy.
4.3.12New command: 'Occup' gets and sets the atom occupancy.
4.3.1Improved plugin support: 'NumberInputMenu[1-6]' allows to input 1 to 6 numbers and pass them to the plugin.
4.2.27Improved commands: 'LoadSce', 'LoadPDB' and several other commands are now much faster for large files.
4.2.15Workaround for an ATI Radeon Linux driver bug that caused color problems and showed random triangles (verified for fglrx 4.3.0-3.7.0 and Radeon 9600Pro)
4.2.14New Yanaconda functions: 'sqr X' function returns X*X, 'cube X' function returns X*X*X
4.2.11New command: 'Transfer' an object to the coordinate system of another object (e.g. if you moved one of two superposed objects away and want to get it back).
4.2.1Improved command: 'AtomSize' can now freely change the atom sizes, which is the same as moving the near clipping plane. Helpful when cutting surfaces open.
4.2.1Inconvenience solved: Showing just the side-chain and CA atom (e.g. in a ribbon) is now trivial (click on 'Show atoms').
4.1.25Improved pKa prediction accuracy in the 'Neutralization' experiment (YASARA Dynamics+)
4.1.15Workaround for a SiS OpenGL driver bug that crashed YASARA (verified for SiS 650M chipset)
3.12.24New Yanaconda functions: 'abs' function returns absolute values, 'sign' returns the sign (-1,0 or 1)
3.12.23Improved command: 'Clean' automatically corrects CG/CD atoms in Val/Leu that got swapped.
3.12.21Improved secondary structure assignment for wrong structures with lots of bumps.
3.12.18New command: 'Span' allows to determine the first and last atom or object spanning a selection. Very useful in macros.
3.12.11Command line arguments that do not end in .mcr, .yob, .sce are assumed to be PDB files and loaded instantly.
3.11.24Improved command: 'DelLink' now handles problems caused by incorrect PDB files with single-sided bonds.
3.11.23New plugin support: Python error messages are now displayed directly on screen including a traceback, also under Windows.
3.11.17New highlight: The 'SwapAtom' command now also adjusts the bond lengths, making building easier. E.g. to add a methyl group to a hydroxyl group, just swap the hydroxyl hydrogen to carbon.
3.11.16New command: 'UserInput' allows to disable disturbing user input during a non-interactive movie.
3.11.16Improved command: 'RayTrace' now also works for electrostatic potentials and simulation grids.
3.11.14New command: 'OnError' allows to handle errors in a running macro. This command replaces 'ErrorExit', which is now deprecated.
3.10.27New command: 'RequireVersion' allows to check if a minimum YASARA version is installed.
3.10.26New plugin support: Various workarounds for bugs in Windows solve some cases where Python plugins could not be run.
3.10.26New graphics engine: YASARA now runs better on old cards, especially those with Riva TNT chips.
3.10.25Improved command: 'Cell' now also returns the coordinates of the cell center and can be used to create non-centered cells (YASARA Dynamics+).
3.10.24New Yanaconda function: 'rnd' function returns random numbers, variables 'Linux' and 'Windows' define operating system.
3.10.20Improved command: 'MakeTextObj' returns the number of the created object (YASARA Model+).
3.10.19New highlight: Distances, angles and dihedrals can be changed interactively by marking up to four atoms and clicking on 'Geometry' in the atom context menu (YASARA Model+)
3.10.19Improved command: 'Distance', 'Angle' and 'Dihedral' can now actively change the geometry.
3.10.17Improved command: 'CheckCis' and 'CheckIso' can now be applied to individual residues, e.g. non-prolines
3.10.16New command: 'Count' the number of atoms to objects that are contained in a selection.
3.10.15Improved feature: Macros can now use the predefined variables 'Residues' and 'Objects' (in the soup).
3.10.15Improved command: CheckCis and CheckIso now return the number of cis-peptide bonds or wrong isomers.
3.10.15Improved feature: Press <CTRL>+<M> to rerun the last macro, including those chosen from the command line.
3.10.15New feature: RightClick in the VISibility column of the 'Scene Content' head-up-display to switch all other objects off.
3.10.11Improved plugin: The error report plugin adds an option to request YASARA updates from the Help menu.
3.10.11New command: 'RenameSeg' allows to change the segment ID for an atom selection.
3.10.11Improved selection syntax: the 'not' operator allows to negate entire selection blocks.
3.10.10New loop database (YASARA Structure).
3.10.10Improved support: ATI Radeon 9600 cards under Linux now fully tested.
3.10.5New highlight: Press the top right button in the sequence selector to display structural alignments.
3.10.5Important bug fix: Playing YASARA Movies from YASARA View works again. Click Help > Play movie > 'Interactive Simulations for Modeling'.
3.10.4Improved secondary structure assignment for unusual helices.
3.9.24Improved command: LoadPNG now imports the alpha channel as well.
3.9.23New command: 'UnrestImage' lets an animated image disappear immediately (YASARA Model+).
3.9.19Improved command: PlayMacro and PlayMovie can be repeated by pressing <Ctrl>+<M>
3.9.11Improved graphics: If an atom makes more than four bonds (defined via CONECT records in the PDB file), YASARA makes a better choice which four bonds to show.
3.9.10Improved command: 'Link' uses more sensitive cutoffs when searching for bonds.
3.9.8Improved PDB writer: If multiple NMR models are saved in one PDB file, the CONECT records are now collected at the end and atom numbers do not restart at 1.
3.9.8Improved PDB reader: Single amino acid ligands are graphically displayed as HetGroups and not linked if they have both C-terminal oxygens
3.9.8Improved command: 'Clean' now replaces missing backbone oxygens including both C-terminal ones
3.9.7New command: 'Move<Atom|Res|Mol>' moves atoms in the local coordinate system of an object
3.9.7New command: 'SwapImage' changes the priority of bitmaps when displayed on screen
3.9.3New plugin: Interface to the PDBFinder2 database. Click Analyze->PDBFinder2 to color your protein according to HSSP sequence conservation, entropy and PDBReport quality indicators.