Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 


List of new features up to version 10.7.20

Here you can check which improvements to expect from a YASARA update. The list below only contains new features and major bug fixes since the first publically available release (3.9.1), small changes are not included. You may have to press the Reload button in your browser .


VersionNew feature
10.7.20Fixed a problem with raytracing of arrows
10.7.7New feature: YASARA plugins and scripts support Python 3.X and 2.X in parallel.
10.7.6Fixed a problem running macros from the command line.
10.7.4New support for automatic simulation of Vanadium-Oxygen clusters like in 3GQI.
10.6.16Improved selection language: Ranges of residues match even if the ends are missing, e.g. DelRes 10-90 deletes a molecule that consists of residues 20-80 only. See Selections > Ranges can be specified.
10.6.13Fixed a problem with some Linux graphics drivers where the entire screen turned black while YASARA started.
10.6.10Improved macros for NMR structure determination: It is now easier to run individual refinement steps manually, see NMR recipes section.
10.6.7Improved command: 'Align' displays both single-line FASTA and multi-line BLAST alignments.
10.6.4Improved command: 'RenumberRes' provides a new 'Increment' parameter to set the residue number increment.
10.6.2New feature: The homology modeling experiment creates a position specific scoring matrix (PSSM) from Uniprot before searching the PDB for templates to increase sensitivity.
10.5.30New workaround for a bug in the BLAST program which makes it occasionally miss a hit.
10.5.25Improved command: 'Clean' deletes 'UNL' residues, i.e. unknown ligands consisting of oxygen only (2HBW,3MPR)
10.5.21New feature: The YASARA manual is now also available as a single PDF file for your eBook reader. See Essentials > Getting started.
10.5.19Fixed a problem with HTTP proxy authentication based on username and password.
10.5.14New command: 'Browser' sets the command used to show HTML files like the documentation. Click Options > Web browser.
10.4.27New convention: To avoid pitfalls when working with homo-oligomers, the commands Sup, RMSD, GDT and the 'with occurrence in' operator now consider the molecule name when matching selections.
10.4.10New plugin mostly for academic users, contributed by Joost van Durme: An interface to the FoldX program ( http://foldx.crg.es ) enables free energy predictions of protein stability, point mutations and interactions. The latest version of the plugin and installation instructions are provided at http://switch.vub.ac.be/foldxyasara . A free energy guide has been added to the Recipes section, which is especially important for commercial users.
10.4.8Improved macro: md_run uses a cubic simulation cell by default (unless 'cubic' is set to 0), so that also elongated proteins can rotate freely during long-term simulations without crossing periodic boundaries.
10.4.7Improved macro: md_analyze contains a 'pdbsaved' flag to convert the trajectory to PDB format for further analysis.
10.4.5Improved command: 'AlignObj' supports the new method 'SHEBA' to run SHEBA also from macros, not only as a plugin via the graphical user interface (Linux and MacOSX only).
10.4.1New version 1.2.1b of the Advanced Poisson Boltzmann Solver APBS has been included in YASARA.
10.3.24Improved plugins: Options can be added to the HUD context menus in the top right corner, see Plugins > Plugins must stick to format conventions > The menu structure is enclosed.. > HUD*ContextMenu.
10.3.21Improved macro: md_runmembrane places counter ions more safely and keeps water more reliably outside the membrane during the equilibration.
10.3.20Fixed a problem with the activation of quad-buffered stereo in Windows.
10.3.17Improved command: 'Console open' opens the console and waits for input, for example to show results printed from a macro or plugin.
10.3.14Improved experiment: 'HomologyModeling' can build hetero-oligomeric models from homo-oligomeric templates.
10.3.6New feature: The 'WinFont' command accepts a new parameter to adjust the window font size from 8 (tiny) to 12 pixels (normal), click Window > Font > Size.
10.2.30New workaround for an Ubuntu problem where YASARA could hang when resizing the window
10.2.15Fixed a problem with temperature measurements in the NOVA force field present since version 9.9.22. NOVA is normally used for minimization only, which does not depend on the temperature and was thus not influenced by this problem.
10.2.10New feature: The LoadSMILES command can now convert SMILES strings to full 3D coordinates, click File > Load > Other fileformat.
10.2.7Improved command: The Z-scores returned by 'Check' have been renormalized, and are more tolerant regarding deviations from ideal bonds, angles and planarities.
10.2.3Improved commands: 'AutoMove', 'AutoMoveTo', 'AutoRotate' and 'AutoRotateTo' also work in console mode.
10.2.1New highlight: YASARA provides identification, analysis and visualization of internal cavities. The ShowCavi command shows them as newly created cavity objects. Click View > Show cavity.
10.1.30New command: 'FirstCavi' identifies the most prominent atom or residue facing each cavity. Click Analyze > Volume of > Cavity and first.
10.1.28Improved macros: The NMR structure determination macros have been simplified and use the MacroTarget just like other macros. See the updated docs in the Recipes section, you may have to rename the sequence and XPLOR table files of existing projects.
10.1.26New command: 'CaviVol' calculates cavity volumes. Click Analyze > Volume of > Cavity in or at.
10.1.24Improved command: 'ScaleObj' can scale polygon meshes, the 'ScaleMesh' command is deprecated.
10.1.22Improved command: 'CenterObj' can center polygon meshes.
10.1.20Fixed a problem from version 10.1.18 that could prevent YASARA from starting in Windows.
10.1.18New release of the YASARA and YASARA2 force fields: They are now significantly more accurate when dealing with small molecule ligands.
10.1.16Improved experiment: 'HomologyModeling' supports gene fission, where multiple target molecules map to the same template molecule.
10.1.14New feature: The homology modeling experiment supports post-translational backbone modifications, i.e. prosthetic groups that interrupt the peptide chain. See the doc section 'Useful homology modeling hints' for details.
10.1.12Improved macro: 'md_runmembrane' supports porines with a transmembrane water channel.
10.1.8Fixed a BLAST database update problem that could raise the error "BLAST could not be run successfully, it signalled error 1"
9.1.3Improved experiment: 'HomologyModeling' supports a 'Residues' parameter to set the maximum and minimum number of model residues (avoiding very large and small models)
9.12.27Improved experiment: 'Neutralization' keeps water molecules that have been fixed with FixAtom.
9.12.23Improved command: 'Stereo' betters shows fore- and background images, especially when molecules protrude from the screen.
9.12.13New database with now 18000 structures for knowledge-based loop modeling.
9.12.10Improved command: 'ListHBo' accepts a new 'Min' parameter to set the minimum energy threshold for hydrogen bonds, and a 'Results' parameter to return more detailed results for analysis.
9.12.3New downloader for sequence databases etc., that can resume downloads that got interrupted by shaky internet connections.
9.11.22Improved macro: 'md_runmembrane' can use any custom membrane, check the docs at Recipes > Run a molecular dynamics simulation > Running a membrane simulation the easy way.
9.11.21New command: 'CompareBond' finds differences among covalent bonds, click Analyze > Compare > Bonds (Model+).
9.11.19Improved command: SurfDis can additionally return the coordinates of the closest surface point.
9.11.13Improved experiment: The homology modeling report lists the target residues covered by each model.
9.11.12Fixed a homology modeling problem, which caused top scoring templates to be skipped if they shared too much target coverage with others.
9.11.11Improved atom coloring using RGB colors
9.11.9New feature: Side-chain prediction with method SCWALL (also used during homology modeling) runs 30% faster now.
9.10.25Improved macro: 'md_analyze' additionally calculates the average energies and RMSDs.
9.10.24Fixed a problem that could stop a simulation with the error message 'Simulation failure imminent. Minimizing...'. Please update now if you have version 9.9.28 or newer.
9.10.22New command: 'ShowRing' fills rings with polygons, whose colors can optionally depend on the ring planarity. Click Effects > Show rings in (Model+).
9.10.20Improved command: 'ColorPar' accepts a 'Ring' parameter to set the color scheme for ring planarity (applied by the ShowRing command) (Model+).
9.10.18New feature: Multiple monitors are now better supported in Windows, the YASARA window remembers its position on the virtual desktop.
9.10.13Fixed a problem when simulating water molecules without periodic boundaries, please update now if you have version 9.9.28 or newer.
9.10.12Improved display: Antialiasing is now turned off temporarily and automatically to prevent huge slowdowns with certain compressed scenes.
9.10.11Improved macro language: The unit of the predefined Boltzmann constant 'BoltzConst' has been changed from J/K to either kJ/mol*K or kcal/mol*K, depending on the current EnergyUnit, which saves a multiplication with JToUnit.
9.10.10New feature: The homology modeling experiment skips templates if followups cover new parts of the target sequence, allowing to reach full coverage with fewer templates.
9.10.9Improved macro: 'md_runmembrane' can detect membrane anchor lipids to correctly 'embed' proteins without transmembrane regions.
9.10.8Improved command: 'SwitchObj' can be combined with visibility 'OnOff' to sequentially switch objects on and off, creating an animation, e.g. of NMR ensembles or GAMESS output files. Click View > Switch object > On & off.
9.10.7Improved command: 'LoadGAM' loads all conformers of a GAMESS output file as separate objects.
9.10.5New command: 'ShowCon' visualizes contacts and bumps. Click View > Show contacts (Model+).
9.10.4Improved command: 'ColorPar' supports the new keyword 'Contact' to set the color range when showing contacts.
9.10.3New feature: The 'ListCon' command accepts additional parameters to fine-tune the contact selection, and now makes it easy to list bumps. Contacts are now listed in one direction only. Click Analyze > List contacts (Model+).
9.10.2Improved command: 'SaveSim' can also save single snapshots instantaneously, if the steps parameter is omitted.
9.10.1Fixed a system library issue in Windows XP, that caused unexpected Syntax errors in Yanaconda macros. Windows XP users, please update.
9.9.30Improved selection language: '!Metal' and 'Metal' and select all (non-)metal atoms.
9.9.29Improved HUD: If more than one atom is marked, all numbers are shown now in the top left corner.
9.9.28New highlight: The 'FixBond' command constrains bond lengths using the LINCS algorithm. This allows to perform simulations with a larger timestep. Combined with the new MD algorithms they now run between 4.1 times (1 CPU core) and 5.2 times (8 CPU cores) as fast as previously. Click Simulation > Fix > Bond. Fixed bonds are colored sky blue (Dynamics+).
9.9.27New command: 'FixAngle' constrains the bond angles in TIP3P water molecules using the SETTLE algorithm, enabling simulations with rigid water molecules. Click Simulation > Fix > Water geometry.
9.9.26New feature: YASARA supports the SSE4.1 instruction set, increasing performance on 45 nm Penryn-based Core 2 Duo CPUs released in January 2008, and newer CPUs.
9.9.25Improved macro: 'md_run' can use constraints and a larger timestep to speed up simulations, snapshots are now saved every 25ps by default. If the macro is run to continue an old simulation, the old snapshot interval will be kept.
9.9.24New feature: The 'Stereo' command includes preliminary support for anaglyph stereo using red-cyan filter glasses. Note that colors require tuning, click Window > Stereo > Red-cyan & tune colors (Model+).
9.9.23New command: 'FreeAngle' removes bond angle constraints in TIP3P water molecules added with 'FixAngle', click Simulation > Free > Water geometry.
9.9.22New highlight: YASARA's molecular dynamics algorithms have been rewritten. For a typical protein simulation in explicit solvent, they run between 3.2 times (1 CPU core) and 4.3 times (8 CPU cores) as fast as previously, and require significantly less memory.
9.9.21New CPU support policy: The new algorithms for much faster MD simulations cannot run on the 1st generation of AMD Athlon CPUs (3DNow! only), sold between 1999 and 2001. YASARA therefore no longer starts on this CPU and displays an error message instead.
9.9.20New feature: Thanks to the new MD algorithms, the occasional error messages about a 'search grid overflow' are gone forever.
9.9.19Improved command: 'SimSpeed' activates dynamic load balancing to fine tune work distribution among CPU cores. Avoid when possible, since simulations become non-reproducible.
9.9.18New feature: YASARA supports the SSSE3 instruction set, increasing performance on Intel Core 2 Duo and newer CPUs.
9.9.17New command: 'FreeBond' removes bond length constraints added with 'FixBond', click Simulation > Free > Bond.
9.9.16New highlight: The new macro 'md_runmembrane' runs MD simulations of membrane proteins fully automatically. It also identifies the transmembrane region and embeds the protein. See Recipes > Run a molecular dynamics simulation > Running a membrane simulation the easy way (Dynamics+).
9.9.15New feature: The 'PressureCtrl' command supports a 'Manometer' pressure control mode to calculate the pressure from the kinetic energy and virial, which helps simulation of membrane proteins. Click Simulation > Pressure control (Dynamics+).
9.9.15New feature: When loading or saving a scene, this becomes the new 'open document' shown in the YASARA window bar and saved quickly by clicking on the Save icon or File > Save.
9.9.14Improved command: 'ColorPar Element' can set non-standard default colors to improve 3D perception in Anaglyph 3D mode.
9.9.13Improved command: 'SaveMPG' accepts a new 'Frames' parameter to stop encoding after a given number of frames.
9.9.12Improved command: 'Align' with methods LocalSeq and GlobalSeq uses an additional 'Parameter' to disable focusing and return the pure sequence alignment.
9.9.11Improved permission handling: If you change the permissions of the 'yasara' directory using 'chmod -R o-rwx yasara' (or go-rwx), YASARA will keep these setting for newly created files inside the yasara directory.
9.9.10Improved command: 'Label' supports the new keywords 'ATOMELEMENT' and 'ATOMElement' to label with the chemical element symbol. Click Effects > Label > Atom.
9.9.9Improved experiment: 'Docking' allows flexible docking also with atoms that are not bound to the rest of the ligand (normally ions).
9.9.8New selection language featue: The 'with hydrogen bond' operator selects atoms based on hydrogen bonds made.
9.9.6Improved command: 'Align' can return the percentage sequence identity as the second return value if the new 'Results' parameter is set to 4.
9.8.30New selection language feature: 'AminoAcid' and 'Nucleotide' select residues of the corresponding type. 'Protein' and 'NucAcid' no longer select single residues, but require at least two bound amino acids or nucleotides to match.
9.8.24Fixed a Linux problem with some newer X-servers, where it was not possible to leave YASARA's menus by clicking outside.
9.7.24Improved macro: 'md_refine' uses the 'Check' command in YASARA Structure to perform structure validation, making it easier to pick the best refinement snapshot.
9.7.10Improved commands: 'SplitObj' and 'JoinObj' are now also available in YASARA View, click Edit > Join > Object.
9.7.7Fixed a bug in the manual: The Yanaconda section 'Lists can be sorted' contained an incorrect sorting example (Objects-2 instead of Objects-1).
9.6.17Improved command: 'Clean' corrects atom names that appear more than once per residue.
9.6.16Improved command: 'Sim Init' displays newly created topologies without hydrogen numbers, so that they can be copy/pasted into *.fof files. If you need hydrogen numbers for use with other programs, use the 'SavePREP' command.
9.6.14New feature: The 'SMILESRoot' and 'SMILESMember' keywords allow selections using SMILES strings. See Selections > Additional selection types > 'SMILESRoot' and 'SMILESMember'.
9.6.13Improved command: 'CountBond' supports a 'Type' parameter to count only bonds that are free to rotate (Dynamics+).
9.6.12New feature: YASARA command files can be used to execute YASARA commands from your own interactive application. See Essentials > Running YASARA in special environments > Running YASARA from other applications.
9.6.10Fixed a potential BLAST problem in Linux and MacOSX, causing the error message 'BLAST could not be run successfully'.
9.6.9New command: 'SurfESP' calculates electrostatic surface potentials, click Analyze > Surface > Area and ESP of (Dynamics+).
9.6.7Fixed a startup problem in the YASARA Dynamics Twinset for Windows.
9.6.2Improved command: The 'Resonate' flag of the Load* command can now be used to disable bond typing.
9.5.24New command: 'SurfDis' calculates the distance from the surface, click Analyze > Geometry > Surface distance of (Model+).
9.5.23New command: 'Transformation' provides access to the coordinate transformation of the last preceding 'Sup', 'Align' etc. command in seven formats (Matrix, Quaternion, Angles...).
9.5.22Improved command: 'Label' supports alternative atom naming schemes using keywords like ATOMNAMEPDB or ATOMNAMEIUPAC.
9.5.20New command: 'SaveSeq' saves the sequence of a selection in FASTA format. Click File > Save as > FASTA sequence.
9.5.18New command: 'Sequence' extracts the sequence of a selection in 1-letter code. Click Analyze > Sequence of.
9.5.17New command: 'GroupBox' calculates the bounding box that fully encloses a selection of atoms.
9.5.15Fixed a problem in the AMBER03 force field, where negatively charged cysteine (CYM) had a non-integral charge.
9.5.13Improved command: 'Boundary' can also return the current cell boundary, either 'periodic' or 'Wall'.
9.5.10New command: 'CountBond' counts covalent bonds between two atom selections. Click Analyze > Count > Bonds.
9.5.9Fixed a user interface pitfall: Clicking Simulation > Timestep during a simulation to change the number of simulation steps per screen update also rounded the default 1.25fs timestep of md_run.mcr to 1.2fs.
9.5.8Improved macro: md_convert has been simplified, it can convert trajectories to a series of PDB files, and can keep a certain atom centered in the cell to remove a drift through periodic boundaries, also from existing trajectories.
9.5.7Improved command: 'Move' can move atoms during a simulation without ending it.
9.5.6Improved command: 'Clean' deletes wrong surplus bonds formed by hydrogens, e.g. in 1A08 revision 2.
9.5.5Fixed an atom type assignment problem which caused planar carbocations to become non-planar during an energy minimization.
9.5.4Improved macro language: The 'sort' function sorts a list, see Macros > Lists can be sorted.
9.5.3New highlight: The 'Stereo' command supports interlaced stereo for 3D screens like the Zalman ZM-M220W, which works with any graphics card and costs just 200 EUR (Model+).
9.5.2Improved experiment: If the homology modeling parameter 'DelTemplateRes' is specified, YASARA will no longer delete waters and buffer molecules, giving full control over which hetgroups to keep.
9.5.1Improved command: 'ShowImage' shows background images also in stereo mode, which helps YASARA movies.
9.4.30Improved experiment: 'Neutralization' supports a 'Vacuum' parameter to define a vacuum region where no water will be placed even if there is a hole, e.g. in a membrane.
9.4.19New workaround for a YASARA window resize problem with ATI fglrx Linux drivers.
9.4.12Improved experiment: 'Minimization' runs initially faster and uses a new convergence criterion. Existing macros that use the 'Convergence' parameter will continue to work, but could be speeded up by adjusting the convergence.
9.4.11New feature: 3DConnexion controllers like SpaceBall or SpaceNavigator are now also supported in Windows (Model+). Contributed by Ahmet Sacan.
9.4.10New workaround for a bug in NCBI's BLAST that still had problems with directory names containing spaces. If you encountered this problem, you can now move the YASARA directory back.
9.4.9Improved macros: dock_run.mcr and dock_runlocal.mcr show progress during the final analysis stage and create consistent filenames also if the MacroTarget ends with a number.
9.4.8New workaround for a problem in Windows' memory manager that could prevent the Twinset with YASARA Structure from building homology models or selecting the YASARA2 force field.
9.4.6New command: 'Accel' gets or sets the acceleration acting on atoms to help steered molecular dynamics simulations.
9.3.30New feature: With the latest PDB format improvements at the RCSB, every PDB file finally contains reliable information about the biologically relevant oligomerization state. The homology modeling experiment therefore no longer uses the PQS database but relies on the PDB only, and automatically downloads new PDB files if the local ones are outdated.
9.3.28New feature: All standard macros like md_run.mcr now use the new, slightly more accurate AMBER03 instead of the older AMBER99 force field. Attention: if you use md_run to continue an old trajectory, this will be done with the new force field. In YASARA Structure, md_run additionally optimizes the hydrogen bonding network.
9.3.27Improved command: LoadPDB stores newly downloaded files in the local PDB if a path has been set, overwriting older, outdated versions.
9.3.26New feature: The homology modeling experiment supports a 'Speed' parameter to build models much faster, but with reduced refinement (which may still be helpful if thousands of models are needed quickly). See the new hm_buildfast.mcr. Note that this parameter was also added to the Python interface.
9.3.24Improved command: 'Oligomerize' chooses new non-redundant molecule names for all copies and also deletes molecules if the selected object contains more than one biomolecule. Proper function may require to download the latest version of some PDB files.
9.3.22New feature: 'BuildRes' and 'AddRes' support a 'Tau' parameter to specify the N-CA-C bond angle. Note that the new parameter has not been simply added at the end, requiring a modification of macros that use the parameters 'Center','End' or 'Isomer' without naming them.
9.3.21Improved command: 'Load*' supports a 'Model' parameter to load only one of many molecules in a multiple-molecule file.
9.3.20New workaround for a bug in Intel Series 4 Notebook chipsets which showed a black screen when the console was opened and experienced slowdowns.
9.3.15New macro: em_run.mcr runs an energy minimization, automatically adding a water shell if a force field other than NOVA is selected.
9.3.10Improved selection language: 'fixed' and '!fixed' allow to select (un)fixed atoms.
9.3.8New feature: 3DConnexion controllers like SpaceBall or SpaceNavigator are now also supported in MacOSX (Model+).
9.3.7Fixed a potential pitfall: Changes to alignment parameters are not saved anymore in yasara.ini, so that YASARA always creates the same alignments after a restart.
9.3.6Improved Python modules: YASARA can be used interactively while the module is running, the 'Wait' command no longer returns immediately.
9.3.3Improved command: GrabObj can grab multiple objects for mouse movement even if their positions differ (Model+).
9.3.2New command: 'PosOri' sets/gets object positions and orientations in one go, the output can be copied directly to macros.
9.3.1Improved plugin: The animated GIF/MPEG clip creator makemovie.py now also works in Windows. Contributed by Ahmet Sacan.
9.2.27Improved command: 'Duplicate' can create copies of all objects (including polygon meshes), not just those with atoms.
9.2.22New feature: YASARA's secondary structure assignment algorithm identifies 3-10 helices, named 'G' in the sequence selector and colored yellow by default. The SecStr command returns additional 3-10 helix data.
9.2.21Fixed a Twinset for Windows startup problem (Error 846, Path name too long).
9.2.20Improved sequence selector: for consistency, beta strands are now labeled 'E' instead of 'S'.
9.2.19Improved command: 'Radius' calculates the mass-weighted radius of gyration if 'Center' is set to 'Mass'.
9.2.18Improved plugin: Object sampling with CONCOORD uses a new version that solves convergence problems.
9.2.15Improved command: 'Compare' supports a new 'CheckMol' flag to toggle the comparison of molecule names.
9.2.13Improved force field parameter assignment: YASARA tries to read the oxidation state of metal ions from the residue name (FE2,FE3 etc.) if no matching topology is found.
9.2.9Improved command: The Color command supports a new 'MapCons' parameter to color by conservation in a user-supplied alignment.
9.2.8New commands: 'BinDistance' collects distance statistics, 'RDF' calculates the corresponding radial distribution function (Dynamics+).
9.2.7Improved command: 'FillCellWater' avoids bumps between waters across periodic boundaries to facilitate the following energy minimization.
9.2.6Improved experiment: Homology modeling uses a new loop database which yields better results for loops longer than 20 residues.
9.2.5New feature: The 'BuildAtom', 'BuildRes', 'BuildMol' and 'AddRes' commands are now freely available in YASARA View. Click Edit > Build and watch the help movie 'Building small molecules'.
9.2.4Improved selection language: 'Water' selects H2O, HO-, H3O+ and single oxygens, the 'DelWater' command is now also based on chemical connectivity instead of residue names.
9.2.3Fixed a loop modeling problem from version 9.2.2, please update before building a homology model.
9.2.2Fixed a startup problem of the Twinset for Windows (application failed to initialize, error 0xc000005).
9.2.1Improved experiment: Homology modeling supports a new 'TermExtension' parameter to specify how many terminal residues (that don't align to anything in the template) should be added at most.
9.1.31Improved commands: ShowDoc, SearchDoc and ShowCom open only a single instance of Safari in MacOSX, even if issued multiple times.
9.1.30Improved experiment: Homology modeling corrects manually provided alignments to make sure that they make physical sense.
9.1.29Improved command: 'ListHBo' allows to detect cases where a hydrogen can form two H-bonds at the same time.
9.1.28Improved experiment: Homology modeling keeps track on a per-residue basis how the various templates cover the target sequence to improve results for multi-domain targets (these should however still better be submitted separately).
9.1.27Improved force field parameter assignment: YASARA distinguishes between carbanions (pyramidal) and carbocations (planar) based on the geometry and assigns the matching net-charge and atom type.
9.1.25New molecular modeling help movie: '4.4. Domain replacement' shows how to transfer domains or loops between proteins, for example to build hybrid templates for homology modeling. Contributed by Ahmet Sacan.
9.1.24Improved force field parameter assignment for molecules with rings of length 3 and 4 (e.g. beta-lactam) (Model+).
9.1.23New command: 'RotAxis' rotates atoms or objects about an arbitrary axis, click Effects > Rotate about axis.
9.1.22Improved experiment: Homology modeling offers the 'DelTemplateRes' keyword to delete a selection of template residues (e.g. ligands which you do not want to keep in the model) (Structure).
9.1.20Improved command: 'Link' supports a new option to also find dative bonds to metal ions, click Edit > Find bonds in.
9.1.19New command: 'KinEnergy' calculates the kinetic energy, click Analyze > Energy > Kinetic energy (Dynamics+).
9.1.18Improved experiment: Homology modeling puts more emphasis on conserved residues in loop modeling, to better keep ligand binding residues close to insertions/deletions in place. Dative bonds to metal ions are automatically added now (Structure).
9.1.17New command: 'Speed' gets or sets the center of mass speed and velocity vectors of selected units (Dynamics+).
9.1.16Improved force field parameter assignment: The bond angles involving dative bonds to metal ions (ShowArrow/CONECT) are now also restrained, to better keep the structure of complicated prosthetic groups like iron/sulfur clusters during a simulation (Dynamics+).
9.1.15New command: 'GroupCenter' calculates the geometric center or the center of mass (Model+).
9.1.14Improved macro language: Yanaconda contains the predefined variables MassUnit (atomic mass unit), BoltzConst (Boltzmann constant), AvoConst (Avogadro constant) and JToUnit (conversion from J to current energy unit).
9.1.13New highlight: The 'Cut' command creates cut-plane objects that cut polygon meshes (e.g. surfaces) open to look inside. Watch the new molecular graphics help movie 'Cut-Planes' (Model+).
9.1.11New feature: Python plugins can now directly obtain return values from YASARA commands, see Plugins > Plugins can access most YASARA functions.
9.1.10New highlight: YASARA includes APBS, the Adaptive Poisson-Boltzmann Solver by Nathan Baker et al. to calculate solvation energies and electrostatic potentials considering implicit solvent and counter ions (Dynamics+).
9.1.9New feature: The 'SolvEnergy' command supports two new methods to calculate solvation energies, 'PBS' (using APBS, the adaptive Poisson Boltzmann Solver) and 'Empirical', a fast empirical approximation. The dielectric constant parameters are deprecated, use 'SolvPar' instead. Click Analyze > Energy > Solvation (Dynamics+).
9.1.8New highlight: The 'ShowESP' command (now in the View menu) has been replaced with a new version that supports various graphics styles including contour surfaces of the electrostatic potential. Watch the new molecular modeling help movie 'Electrostatic Potentials' (Dynamics+).
9.1.7New command: 'SolvPar' sets solvation parameters for calculation of electrostatic potentials and surfaces, as well as solvation energies. Click Analyze > Energy > Solvation parameters (Dynamics+).
9.1.6New feature: The 'ShowSurf' and 'ColorSurf' commands can color surfaces by electrostatic potential, calculated either with the Particle Mesh Ewald (ESPPME) or the Poisson-Boltzmann approach (ESPPBS). The 'ESP' method is deprecated.
9.1.5New command: 'OriVec' calculates the Euler-like orientation angles corresponding to one or two vector directions.
9.1.3Improved plugins: Menu options (for example long dynamic lists for the ListMenu) can be read from disk, see Plugins > The menu structure is enclosed in a triple-quote comment > ListMenu.
9.1.2New workaround for a bug in Windows Vista which caused the <Tab> key to get stuck when switching between windows.
9.1.1New convention: The commands 'AddBond', 'SwapBond' and 'SwapAtom' no longer update hydrogens and bond lengths by default. This has to be requested explicitly by setting the 'Update' parameter to 'Yes'.
8.12.31Improved macro language: The called function must use a list creator '()' to indicate if a single value or a list should be accepted from the caller, this change is not 100% backwards compatible. See Macros > Calls to user-defined functions must appear one per line.
8.12.30Fixed a download problem with BLAST databases and modeling templates, that could time-out too soon with a bad Internet connection.
8.12.29Improved macro language: The 'caller' keyword allows to access variables in the calling function to implement a general 'call by reference' (See Macros > Calls to user-defined functions must appear one per line).
8.12.28Fixed a problem with undo/redo present since 8.10.15 that caused object positions or orientations to be set incorrectly.
8.12.27Improved macro language: The 'hex' function converts an integer to a hexadecimal string.
8.12.19Improved macro: 'md_refine' now uses the new YASARA force field in YASARA Structure.
8.12.18Improved experiment: Docking supports a new 'DockPar' option which allows to include any parameter you want in the AutoDock docking parameter file. The explicit use of 'ga_num_evals X' etc. is now deprecated, replace with 'DockPar ga_num_evals X'.
8.12.16Fixed two error messages in the homology modeling experiment.
8.12.14Improved command: 'Cell Auto' accepts a selection of atoms to enclose, for example residues in a binding site for docking. Click Simulation > Define cell.
8.12.12Improved experiment: Homology modeling includes the target coverage in the alignment score, so that less homologuous templates are chosen if they cover more of the target.
8.12.8New feature: The YASARA console supports indentation and auto-completion of command names or filenames, just press <Tab>.
8.12.7Improved command: 'BuildLoop' and 'OptimizeLoop' can use the fast access index also if the atom order in the residue does not match the PDB format (N/CA or CA/C flipped).
8.12.6Improved command: 'SwapAtom' supports a 'Rename' flag to skip atom renaming.
8.12.5Improved experiment: Docking allows to set AutoDock's 'ga_num_generations' parameter.
8.12.4Fixed an error message that could show up in side-chain and loop optimization if more than one object was present.
8.12.3New feature: The RCSB unfortunately changed the download location of PDB files without notice today. If you use LoadPDB with download=Yes or run a homology modeling experiment, please update YASARA now. Downloading from the File menu still works.
8.11.27Improved selection language: It is not an error anymore to select residue numbers that don't exist or to select incomplete ranges.
8.11.25Improved command: 'Radius' supports two additional parameters to calculate the nuclear radius and the radius of gyration, also based on the center of mass instead of the geometric center.
8.11.24Improved command: 'LoadPDB' handles dummy atoms correctly again.
8.11.15Improved command: 'ListAtom' lists the chemical element as well.
8.11.11New highlight: The Yanaconda macro language has been rewritten and runs up to 150 times faster, you can now define your own functions (see Macros > Calls to user-defined functions), and work with entire lists at once (vector processing, see Macros > Lists are emulated..). Combined with the new 3D fonts mentioned below, it is a good time to verify (before an important presentation) that your movies still work as expected. All YASARA help movies have been checked and partly received a visual makeover.
8.11.10Improved macro language: The 'zeroed' function returns a zero with the same number of digits as the function argument to help construct matrices.
8.11.9New feature: 'MakeTextObj' and 'Print' create 3D fonts with proper shading and improved True-Type quality. Since the size of characters changed a tiny bit, movies that precisely arrange molecules and 3D letters may need small adjustments (Model+). Contributed by Ahmet Sacan.
8.11.8Improved macro language: The functions 'crack' and 'fuse' allow to analyze and change individual string characters.
8.11.7Fixed an issue present since 8.10.15, where filling the cell with water could crash occasionally.
8.11.6New feature: 'Label' uses a new True-Type font interface to improve label quality on screen and in ray-traced images. Contributed by Ahmet Sacan.
8.11.5Improved Yanaconda macro language: the 'norm' function calculates the length of a vector (=a list of numbers).
8.11.4Fixed an issue where BLAST would hang (un-)reproducibly (depending on the file system used), if YASARA's installation path contained spaces.
8.11.2Improved command: The homology modeling experiment now excludes templates that cover a significantly smaller fraction of the target sequence than others.
8.11.1The Yanaconda operator '//' now performs a floored division, 3//2 still equals 1, but -3//2 now equals -2. This ensures that division results are equally distributed and do not favor '0'.
8.10.28Fixed an issue where downloading re-refined PDB files during the homology modeling experiment could hang indefinitely.
8.10.27New command: 'Scale' multiplies atom coordinates with a scaling factor. Click Effects > Scale (Model+).
8.10.27Improved experiment: Docking can set the AutoDock parameters ga_num_evals, ga_pop_size and dihe0 directly, see Recipes > Dock > Useful docking hints (Structure).
8.10.27New command: 'ScaleMesh' multiplies vertex coordinates in polygon meshes with a scaling factor, click Effects > Scale > Polygon mesh (Model+).
8.10.26Improved support for running multiple YASARAs on a cluster from an NFS volume, no more lock file errors should show up.
8.10.25Improved Python interface: plugins and Python modules can now also use WHAT IF functions in the Twinset using run("SHOSOU") etc.
8.10.24Improved command: 'Console' supports three modes: on, hidden and off which permit to fine-tune the console appearance. Click Window > Console.
8.10.23Fixed an issue present since version 8.10.15, where going to WHAT IF in the Twinset could crash.
8.10.22Improved typing of small molecules, 5 additional difficult cases are handled now.
8.10.21Fixed an issue present since version 8.10.15, where making significant changes to the scene after marking an atom could crash.
8.10.20Improved instructions for using minimal YASARA movies as course lessons (see Recipes > Create your own YASARA movies > Minimal movies can be used to support student courses)
8.10.19Improved splitting of large ligands during force field parameterization now handles most cases automatically.
8.10.16Fixed a startup problem in YASARA for Windows 8.10.15 (Size of struct object is incorrect).
8.10.15New feature: The number of objects in YASARA (Model+) is now unlimited to help with the analysis of thousands of compounds at the same time. Since this feature required changes in every corner of YASARA, don't hesitate to report also the smallest anomalies.
8.10.14New release of OpenBabel included, YASARA now supports 42 additional molecular file formats, 112 in total. Click File > Load/Save as > Other file format.
8.10.13Improved commands: Molecule import and export (Load* and Save*) can handle multiple objects in one file.
8.10.12New command: 'CorrectDrift' removes translational motion of the solute in the cell to prevent it from crossing periodic boundaries. This feature has been included in the md_run macro. Click Simulation > Automatic correction of > Solute drift.
8.10.11Improved commands: 'LoadPDB' and 'SavePDB' preserve COMPND information, 'Label' supports a new 'COMPOUND' tag to insert the per-molecule compound name into labels.
8.10.4New highlight: An interactive oligosaccharide builder plugin is available, including energy minimization of growing sugars. Click Edit > Build > Oligosaccharide (Structure).
8.10.3Fixed a Windows Vista error message when running BLAST and building homology models.
8.10.2New feature: Text files read by YASARA can now be in Unicode format.
8.10.1Improved experiment: Homology modeling detects a wider range of pitfalls when you provide your own template structures.
8.9.28New command: 'SavePrep' creates an AMBER Prep topology file to exchange force field parameters with other programs. Click File > Save as > Other file format (Dynamics).
8.9.25New command: 'LoadPrep' loads molecule coordinates from an AMBER Prep topology file. Click File > Load > Other file format (Dynamics).
8.9.23Improved command: 'Clean' adds internal capping groups to chain breaks.
8.9.21Fixed an incorrect 'out of memory' error message when filling the cell with water (present since 8.9.11).
8.9.20Improved command: 'AddCap' supports a new 'Location' parameter to distinguish between external (chain ends) and internal (chain breaks) caps.
8.9.19Improved command: 'CoordSys' returns the current coordinate system, +1 if left-handed, -1 if right-handed.
8.9.18Improved selection language: The 'with(out) connection to' operator selects atoms depending on their covalent connection.
8.9.11Improved command: The 'FillCellWater' command accepts a new parameter 'DisMax' to create a water shell.
8.9.10Fixed a problem in the Docking experiment, where AutoDock could get trapped in an infinite loop, leading to an out of memory error.
8.9.9Improved command: 'Compare' returns the number of differences found.
8.9.8Improved typing for small molecules, 6 additional difficult cases are handled now.
8.9.3New feature: YASARA supports HTTP proxies for various downloads, read Essentials > Running YASARA in special environments > Running YASARA with web access through an HTTP proxy.
8.9.1Fixed an error message in the HomologyModeling experiment when building hetero-oligomeric models.
8.8.24Improved typing of small molecules, 10 additional difficult cases are handled now.
8.8.23Improved docking: YASARA now reduces the number of energy evaluations for less flexible ligands to speed up docking. Alternatively, the new 'EnergyEvals' keyword can be used to set AutoDock's ga_num_evals parameter.
8.8.21Improved macro language: All YASARA commands return error codes that can be checked, see Macros > Calls to YASARA commands must appear one per line.
8.8.20Improved command: 'LoadPDB' adds missing TER entries if the 'Correct' flag is set.
8.8.19Improved commands: 'Load*' now uses YASARA's bond typer after reading file formats that don't store bond orders.
8.8.17New feature: The 'HomologyModeling experiment' detects gene fusion events where the target sequence covers multiple template molecules and fuses them in the correct order (Structure).
8.8.11Improved command: 'KekulizeBond' and 'Save*' use a new improved algorithm to place double bonds.
8.8.9Improved command: 'TypeBond' considers bond lengths and angles in planar rings to detect molecules with broken aromaticity, and has several other improvements.
8.8.8New highlight: After five years of development, the final YASARA stage 'YASARA Structure' has just been released. You are welcome to join the festive activities by clicking Help > Play help movie > Triple 8 celebration day (Model+). Owners of YASARA View can download the movie from www.yasara.org/movies.
8.8.7New help movie: All the new YASARA Structure features are introduced in a new help movie, click Help > Play help movie > What's new in YASARA Structure (Model+). Owners of YASARA View can download the movie from www.yasara.org/movies.
8.8.6New highlight: The 'Docking experiment' performs small molecule docking using a tuned version of AutoDock. Click Options > Choose experiment > Docking and read Recipes > Dock a ligand to a receptor (Structure).
8.8.5New highlight: The 'OptHyd' command invokes a new pH dependent hydrogen bonding network optimizer that fully considers ligands, click Edit > Add > Hydrogens to object & optimize (Structure).
8.8.4New highlight: The 'HomologyModeling experiment' takes all the steps from a target FASTA sequence to a fully refined homology model and writes a scientific report about the modeling. Read Recipes > Building a homology model (Structure).
8.8.3New highlight: The 'OptimizeLoop' command performs knowledge-based loop optimization considering the current force field and solvation energies. Click Edit > Optimize > Loop (Structure).
8.8.2New command: 'BuildLoop' quickly scans the PDB for backbone conformations that bridge two anchor points, match certain sequence and secondary structure requirements, and don't bump. Click Edit > Build > Loop (Structure).
8.8.1New highlight: Two new force fields are available: The YASARA force field, which has been derived from YAMBER3 by adding knowledge-based dihedral potentials (one-, two- and three-dimensional), and the YASARA2 force field, which contains additional knowledge based 1D and 3D packing potentials. Click Simulation > Force field (Structure).
8.7.31New help movie: 'Knowledge-based potentials' explains all the details of knowledge-based potentials and their use in YASARA.
8.7.30New command: 'ShowKBP' shows knowledge-based potentials, click Analyze > Geometry > Knowledge-based potential (Structure).
8.7.29New highlight: The 'Check' command performs a new kind of force field based structure validation that works also for ligands, supporting 11 different checks. This number grows to 33 checks in the Twinset. Click Analyze > Check (Dynamics+).
8.7.28New highlight: The 'Optimize Method=SCWRL' command optimizes Side-Chains With a Rotamer Library and very fast dead-end elimination using the SCWRL3 algorithm (Protein Sci. `12`,2001-2014). Additional tuning can be done with 'Method=SCWALL', which performs a minimization of the side-chains in dihedral angle space with implicit solvent. Click Edit > Optimize (Structure).
8.7.27New command: 'SampleLoop' performs the same task for an existing loop (Structure).
8.7.26New highlight: The 'PredSecStr' command employs the DSC method to predict secondary structure (King RD and Sternberg MJE, Protein Sci. 5,2298-2310). Click Analyze > Secondary structure > Prediction (Structure).
8.7.25New highlight: The 'ShowIonSites' command predicts ion binding sites, click View > Show ion binding site (Structure).
8.7.24New command: 'SampleDih' changes dihedral angles, either randomly, systematically, or based on data extracted from the PDB. Click Edit > Sample > Dihedrals (Structure).
8.7.23New highlight: The AMBER03 force field has been included, with tuned protein charges and improved protein backbone energetics, see Duan et al (2003) JCC 24,1999-2012 (Dynamics+).
8.7.22New highlight: The 'BLAST' command runs a built-in (PSI-)BLAST, local sequence databases (PDB,SwissProt,TrEMBL) are updated automatically and augmented with additional validation data to identify the best PDB structure for a given sequence. Click Analyze > Blast (Structure).
8.7.21New highlight: The NMR module to determine protein structures based on distance- and dihedral angle restraints has been released. More details at www.yasara.org/nmr and in the docs at Recipes > Solve an NMR structure (Structure,NMR module).
8.7.20New command: 'DelRest' deletes all NMR restraints assigned to an object (Structure,NMR module).
8.7.19New command: 'ShowRest' shows NMR restraints that involve selected atoms (Structure,NMR module).
8.7.18New command: 'HideRest' hides all NMR restraints that involve the selected atoms and have been shown before (Structure,NMR module).
8.7.17New command: 'LoadTbl' loads a table with NMR restraints in XPLOR format (Structure,NMR module).
8.7.16New command: 'SaveTbl' saves a table with NMR restraints in XPLOR format (Structure,NMR module).
8.7.15New command: 'ListFloat' lists the currently floating assignments in ARIA SaveFloat format (Structure,NMR module).
8.7.14New command: 'ListRest' lists currently assigned NMR restraints and corresponding violation energies.
8.7.13New command: 'RestEnergy' calculates NMR restraint violation energies (Structure,NMR module).
8.7.12New command: 'RestViol' calculates NMR restraint violation statistics (Structure,NMR module).
8.7.11New command: 'RestrainDis' adds a new distance restraint (Structure,NMR module).
8.7.10New command: 'RestrainDih' adds a new dihedral angle restraint (Structure,NMR module).
8.7.9New command: 'RestrainPar' sets/gets the current NMR restraining parameters (Structure,NMR module).
8.7.8New command: 'RestrainPot' sets/gets the current NMR restraining potential (Structure,NMR module).
8.7.7New command: 'ScaleRest' scales NMR restraints (Structure,NMR module).
8.7.6New command: 'IntersectObj' performs collision detection between objects.
8.7.5New command: 'RepeatKey' sets the keyboard repeat rate as a workaround for some Gentoo Linux keyboard problems.
8.7.4New convention: due to the increasing number of PDB files with mixed lower- and uppercase chain names (e.g. 1GAV), molecule selections are case-sensitive now. 'Mol a' will no longer select 'Mol A' and vice versa.
8.7.3New feature: Python scripts can interact with Python plugins, see Scripts > Python scripts can interact with Python plugins
8.7.2Improved command: 'Energy' calculates knowledge-based dihedral and packing energies if one of the new YASARA and YASARA2 force fields is chosen (Structure).
8.7.1Improved command: 'SecStr' analyzes and returns secondary structure content also per molecule and object.
8.6.30Improved command: 'GrabObj' can now grab more than one object for interactive movement. Click Effects > Move > Object with mouse.
8.6.29Improved command: 'Clean' replaces selenium and tellurium atoms with sulfur and renames them accordingly.
8.6.28Improved plugin: The object sampling now uses Bert de Groot's Concoord 2.1 and allows to choose different VdW parameter sets. Click Edit > Sample > Object.
8.6.27Improved Yanaconda macro language: the modulo operator '%' now also works on floating point numbers.
8.6.26Improved command: 'Clean' replaces hydrogens that are incorrectly close (e.g. GLN 22 in 1GQV)
8.6.21Workaround for a bug in some new ATI drivers that left the startup screen visible and did not clear the screen.
8.6.8New command: 'SupOrdered' superposes an arbitrary number of selections in an ordered way. Click Analyze > Superpose > Two objects on ordered...
8.5.29Improved selection language: the 'with occurrence in' operator selects atoms that occur in both selections, see Selections > Selections can be combined with explicit operators.
8.5.27New command: 'GDT' calculates the CASP global distance test, i.e. the percentage of atoms that can be superposed below a certain distance cutoff. Click Analyze > Global distance test of (Model+).
8.5.26Improved commands: 'BuildRes', 'SwapRes' and 'AddRes' accept a new 'Isomer' parameter to build also D-amino acids.
8.5.25Fixed a matching problem in 'Sup' and 'RMSD' that occured when more than two objects were superposed with 'Match=Yes', i.e. an RMSD matrix was calculated.
8.5.7New command: 'ElementAtom' gets the chemical element of selected atoms.
8.5.6Improved command: 'RadiusObj' can also obtain the radii of polygon meshes.
8.4.15New command: 'SavePNG' saves a screenshot in compressed PNG format.
8.3.30Improved command: 'Align' initializes the atomic properties to reflect sequence similarity between aligned residues. Coloring by properties thus helps to visualize the structural alignment.
8.3.27Improved command: The minimization experiment supports a new convergence parameter to define how far the minimization should proceed.
8.3.11Improved command: The 'Label' format supports a new 'CHARGE' keyword to display charges of entire units. 'ATOMCHARGE' is deprecated.
8.3.3Improved command: 'Clean' sorts atoms in amino acids in their default order.
8.3.1Reduced CPU usage on some graphics cards, e.g. nVIDIA.
8.2.21Improved selections: the properties 'Ring', 'Aromatic' and 'Visible' are now available in atom selection menus.
8.2.19Improved command: 'SupMulti' now employs the latest version 1.2.7 of Theseus (Linux+MacOSX).
8.2.14Improved YAMBER3 force field: Stronger planarity constraints significantly increase structural quality with only a marginal effect on accuracy.
8.2.10Improved typing of small molecules: 27 additional difficulties are now handled.
8.2.3New feature: the 'SolvEnergy' command also calculates the Van der Waals solvation energy and returns it as the second result. A surface area is no longer returned, PLEASE UPDATE macros that use the second return value.
8.2.2Improved macros: The examples macros at the 'BindEnergy' command now include Van der Waals solvation energies and the entropic cost of exposed surface.
8.2.1Improved command: 'Rotate' can now also rotate atoms in the local coordinate system, the order of rotation is now about the X-, Z- and Y-axes.
8.1.31New command: 'GroupLine' calculates the optimal line through a group of atoms, for example to move atoms along a helical axis.
8.1.30Improved command: 'Clean' corrects incorrectly defined chemical elements, like OD2 ASP A 186 in 1F6W.
8.1.29New command: 'GroupPlane' calculates the optimal plane through a group of atoms.
8.1.28Improved command: Per-atom energy calculations with 'EnergyAtom/Res/Mol' add the dihedral energy to the two dihedral core atoms 2 and 3 instead of 1 and 4. This makes sure that the Phi and Psi dihedral energies stay inside the amino acid they belong to. The same holds for bond angles now.
8.1.26Improved macro language: lists can be assigned to each other, e.g. MyOtherList=MyList.
8.1.20New highlight: YASARA supports side-by-side stereo (parallel and cross-eyed), click Window > Stereo (Model+).
8.1.18Improved command: 'AddRes' accepts a new 'End' parameter to add residues also to the front end of a peptide chain.
8.1.17Fixed an issue where LoadSim complained that simulation snapshots created in the second half of 2007 were corrupted.
8.1.10Improved feature: Object names can now be up to 12 characters long.
8.1.7New highlight: A scene content browser with context menus in the top right head-up display allows to easily and quickly navigate and modify the scene. As a side-effect, <Ctrl> needs to be held down when grabbing an object for movement in the HUD.
8.1.6Improved command: 'CheckObj Bumps' no longer considers crystal symmetry to avoid unexpected results.
8.1.5New commands: 'ShowHUD' and 'HideHUD' toggle the display of selected units in the scene content browser. Click Window > Show/Hide in HUD.
8.1.1New workaround for a backward compatibility bug in MacOSX 10.5. YASARA now also runs in Leopard.
7.12.27Improved support for non-ASCII characters in filenames (UTF-8 etc.).
7.12.25Improved command: 'StyleWin' can adapt YASARA's look to MacOSX 10.5 Leopard. Click Window > Style.
7.12.22Improved secondary structure assignment.
7.12.18Improved command: 'LoadPDB' supports a 'download' flag to automatically download missing PDB files.
7.12.1Improved console: commands typed in can now be longer than the YASARA window.
7.11.28New command: 'ShowPolygon' draws a polygon connecting points or atoms. Read Commands > Effects > Polygons.
7.11.28New command: 'HidePolygon' hides a polgon connecting atoms.
7.11.26Improved Python interface: Selection can now be passed as Python lists [] to YASARA functions in Python modules and plugins.
7.11.25New feature: YASARA's treatment of hydrogen bonds has been reimplemented and accelerated, including angle dependence, more details at the ListHBo command.
7.11.23Improved command: 'Print' accepts an additional parameter 'Convert' to toggle the conversion of escape codes in strings.
7.11.22Improved command: 'ListHBo' also lists the energies of hydrogen bonds.
7.11.18Improved selection language: 'Ring' selects ring atoms, 'Aromatic' aromatic atoms.
7.11.16Improved selection language: 'BFactor','Property' and 'Occupancy' calculate averages over the current selection type.
7.11.14New highlight: YASARA can be used as a Python module, just 'import yasara'. Read Scripts > Use YASARA as a Python module.
7.11.10Improved typing of small molecules: 23 additional pitfalls are now considered.
7.11.3Improved selection windows: The 'Belongs to' list on the right side allows to select segments.
7.11.3New command: 'Seg' complements 'NameSeg' (which performs segment inflation now) and sets or gets segment names of selected units, which helps storing complex selections permanently. See also Selections > Yanaconda helps to define selection subsets.
7.11.2Improved consistency: ListObj also lists inactive objects.
7.10.29New support for NFS mounted multi-user YASARA installations. Read Essentials > Running YASARA in special environments > Running YASARA from an NFS mounted volume.
7.10.27New feature: when a simulation is switched off, YASARA wraps molecules that crossed a periodic boundary such that a maximum number of atoms are placed inside the cell.
7.10.26Improved command: MUSTANG based structural alignments using 'Align' have been speeded up by an order of magnitude in Windows.
7.10.18New guide and features for running YASARA on clusters: read Essentials > Running YASARA in special environments > Running YASARA on a cluster.
7.10.15Improved command: 'Align' accepts an additional parameter to help MUSTANG align difficult oligomers.
7.10.12New behavior: LoadSce now only sets surface parameters if a change of settings is requested with 'Settings=Yes'.
7.10.10Improved command: pKaRes can determine the pKas predicted during a neutralization experiment.
7.9.9New macro: md_runsteered.mcr runs a steered molecular dynamics simulations. More details in the documentation at Recipes > Run molecular dynamics simulations.
7.9.5Improved commands: 'SaveSim' and 'LoadSim' protect the simulation snapshots with a checksum to minimize problems with hard disk data corruption.
7.9.2New highlight: YASARA includes Arun S. Konagurthu's MUSTANG program to create pairwise and multiple structural alignments. Click Analyze > Align > Objects with MUSTANG.
7.8.28Improved command: 'Tabulate' can add strings to a table.
7.8.20New command: 'SaveAli' saves structural or sequence alignments in YASARA or FASTA format. Click Analyze > Align > Save alignment.
7.8.15New highlight: YASARA supports local Smith&Waterman and global Needleman&Wunsch sequence alignments. Click Analyze > Align.
7.8.10New command: 'AlignPar' sets various alignment parameters. Click Analyze > Align > Parameters.
7.7.31New highlight: The 'SupMulti' command superposes multiple objects together using the Theseus maximum likelihood approach developed by Douglas Theobald. This puts more emphasis on structurally conserved regions, allowing to superpose NMR bundles automatically without having to specify a target region. Click Analyze > Superpose > Multiple objects.
7.7.28Improved force field parameter assignment for 3- and 4-rings.
7.7.26New feature: The radii of sticks in balls&sticks and sticks alone can now be set independently. Click View > Stick > Parameters.
7.7.10Improved command: 'Clean' deletes water molecules that overlap with other atoms or each other.
7.7.4New feature: YASARA builds nucleotides, DNA and RNA in all conformations. The 'BuildRes' command builds the first nucleotide, 'AddRes' appends at the 3' end, 'BuildMol' builds an entire nucleic acid based on a sequence.
7.7.3Improved commands: 'ShowTorus' and 'ShowSphere' support a new 'Alpha' parameter to create transparent objects. For 'ShowSphere', this change is not entirely backward compatible.
7.7.2Improved command: 'ListHBo' provides more intuitive output by listing atoms in the first selection that are hydrogen bonded with atoms in the second selection (i.e. bonds are listed in only one direction now).
7.7.1Improved Yanaconda macro language: the 'in' operator checks if a list contains a certain value, the priority of the bitlogical operators has been set higher than comparisons, just like in Python. The variables 'FirstObj' and 'LastObj' store the number of the first/last *active* object and -1 of no object is active.
7.6.29Improved commands: 'ListRes', 'ListMol', 'ListConRes', 'ListConMol', 'ListHBoRes' and 'ListHBoMol' now return unique residue and molecule ids instead of potentially ambiguous residue numbers and molecule names.
7.6.19New feature: Commands like 'SavePDB' now support the forthcoming new PDB format V3.0. Since it is less consistent and likely to cause problems with other programs, the original PDB format stays the default.
7.6.17New commands: 'AddPos' adds atom positions to an internal table, 'AveragePos' and 'RMSF' use these data to calculate average positions and root mean square fluctuations.
7.6.10Improved macro: 'md_analyze' calculates B-factors and the time-average structure from the simulation trajectory.
7.6.5Improved macro: 'md_analyzeres' also calculates per-residue fluctuations
7.5.30Improved command: 'SolvEnergy' is significantly faster, and the results have been optimized for accuracy.
7.5.20Improved command: 'Clean' deletes residues that overlap significantly with other residues and are most likely slightly different ligands bound to the same active site, like BTN/BTQ in 2F01.
7.5.14Improved command: 'Wait' can wait until the users marks an atom, distance, angle or dihedral.
7.5.11Improved command: 'MarkAtom' returns the numbers of the currently marked atoms.
7.5.8New command: 'CorrectConv' corrects errors in naming conventions (methylenes, Val/Leu side-chain flips) during a simulation to aid high-temperature NMR structure determination protocols. Click Simulation > Automatic correction of > wrong naming conventions (Dynamics+).
7.5.4New feature: The 'Check' command performs a new 'NameConv' check of naming conventions (methylenes, Val/Leu side-chain flips) and also handles the checks for cis-peptide bonds and wrong isomers. The old commands 'CheckCis' and 'CheckIso' are now deprecated.
7.5.3Improved command: 'ShowHBo' supports a new 'Extend' flag to extend selections to hydrogen bonding partners, making it easy to show hydrogen bonds involving selected atoms. Click View > Show hydrogen bonds.
7.4.29New movie: Proteins for beginners, NMR structure determination, information content of NOE restraints, refining NMR structures and error detection by Sander Nabuurs, separate download from www.yasara.org/movies.
7.4.27Improved commands: 'Label' and 'Unlabel' can now also (un)label individual segments.
7.4.26New movie: Methionine synthase, example for visualizing enzymatic mechanisms with YASARA, by Richard Deth, separate download from www.yasara.org/movies.
7.4.24Improved command: 'Clean' renames left-over single OT1/OT2 atoms to O.
7.4.22New highlight: YASARA now features an accurate and fast, multi-threaded algorithm to calculate molecular surfaces in real-time including all cavities. Click View > Show surface > Parameters > Numeric.
7.4.18Improved feature: molecular surface calculations using the Gaussian approximation have been calibrated to reproduce the results of the new, more accurate molecular surface algorithm above.
7.4.16New macro: md_analyzesecstr creates a 3D plot and text table of the secondary structure changes during a simulation.
7.4.13Improved speed: YASARA is now compiled with a higher optimization level.
7.4.1New plugin: The ConSurf interface developed by Joost Van Durme and Sebastian Maurer-Stroh colors proteins by sequence conservation (using the ConSurf server by Landau et al.). Click View > Color > Molecule by ConSurf. The similar PDBFinder2 color mapping has been moved to View > Color > Residue by feature.
7.3.30Improved surfaces: Calculations involving surface environments have been speeded up by 25%, surfaces also require significantly less memory.
7.3.28Improved command: 'Transfer' supports three different ways of handling local atom coordinates during an object transfer. When an object is transferred into the simulation cell, its CRYST1 record is set, so that the simulation cell can be saved in PDB files. Click Edit > Transfer.
7.3.21New feature: The 'SurfPar' command allows to choose between two sets of radii for molecular and solvent accessible surfaces. Standard VdW and more realistic effective solvation radii. Click View > Show surface > Parameters.
7.3.20Improved command: 'Dihedral' also sets and gets improper dihedrals if 'bound' is set to 'yes'.
7.3.15New workarounds for many bugs in Linux OpenGL drivers, especially for older video cards like e.g. Radeon 9X00, Intel integrated chipsets, Matrox G400.
7.3.11New highlight: YASARA has been ported to Mac OS X, including special support for Mac gadgets like the Mighty Mouse. Watch the help movie 'Working with YASARA' for details.
7.3.4New command: 'SeqSelector' toggles the display of the sequence selector at the bottom. Click Window > Show sequence.
7.2.26Improved support and workarounds for MESA indirect software rendering in Linux.
7.2.25Improved command: 'FramesPerSec' can also deactivate screen redraws when YASARA is idle to save CPU power. The SavePower command is deprecated.
7.2.24New feature: Hydrogens can be selected by their name according to many different nomenclatures. Read Selections > Additional selection types allow to filter for various properties > 'PDB', 'PDBRev'...
7.2.22Improved command: 'LoadPDB' corrects the hydrogen nomenclature unless 'Correct' is set to 'No'.
7.2.20Improved command: 'AddHyd' adds amide and guanidine hydrogens matching PDB naming conventions.
7.2.18New command: 'AtomSymbol' toggles the display of the chemical element symbol inside atoms that are cut open. Click Effects > Atom appearance > Element symbol.
7.2.15Improved command: 'Clean' swaps amide and guanidine hydrogens to match PDB naming conventions.
7.2.10Improved support for ATI Radeon cards in Linux: if driver >=8.X.Y is installed, graphics run significantly faster.
7.2.7New feature: Compressed files with '.Z' extension can now be loaded directly just like '.gz' files.
7.2.6Improved command: 'CD' allows to always change the working directory on startup, click Options > Change directory.
7.2.5New command: 'ShowButton Continue' shows a continue button and sets the Yanaconda variable 'ContinueButton' to true if pressed.
7.2.4Improved command: 'List' accepts a new 'Compress' parameter to return a compressed selection list, see Commands > Analyze > Scene content > List.
7.2.3New feature: The 'Charge' command has improved capabilities to not only set net charges but also individual atom charges. This change is not entirely backward compatible.
7.2.2Improved user interface: file selection menus provide various shortcuts to Home, Documents, Pictures etc.
7.2.1New command: 'Install' automatically installs POVRay or Python, click Help > Install program.
7.1.30Improved command: 'Raytrace' creates PNG images by default to save disk space.
7.1.28New feature: The neutralization experiment allows to request a certain NaCl contration and thus add more salt ions than needed to neutralize the cell (click Options > Experiment > Neutralization).
7.1.27Improved command: 'Mass' also lists the summed up mass.
7.1.26New command: 'ShowTorus' draws a ring-, horn- or spindle-torus. Click Effects > Show solid > Torus (Model+).
7.1.25Improved window manager: if all animations are disabled, clicks on icons and buttons now provide more visual feedback.
7.1.24Improved Yanaconda macro language: the 'rnd' function can randomize strings, e.g. to create random RGB colors.
7.1.17Improved command: 'JoinObj' can now also join polygon meshes like arrows, spheres, boxes etc.
7.1.14New feature: Dummy atoms (element 0) can now be included in a simulation without causing an error message.
7.1.10Improved command: 'SavePower' now reduces YASARA's CPU requirements to truly 0 if no input is made. Click Window > Save power.
7.1.9Improved command: 'Wait' supports the new unit 'Femtoseconds' to make waiting during a simulation more straightforward.
7.1.7New highlight: YASARA's graphics engine now supports diffuse shadows and ambient lighting for balls to sticks, even on very old video cards. Watch the new help movie 'Lighting and shadows'.
7.1.6Improved commands: 'Sup' and 'RMSD' have improved flipping capabilities for equivalent atoms to minimize the RMSD: Hydrogens are now also considered and flipped atoms are listed in the console.
7.1.5Improved selection language: 'Segment' switches to a selection of macromolecular segments, read Selections > Additional selection types > Segment.
7.1.4New command: 'UndoLevels' sets the number of undo levels without having to edit yasara.ini. Click Options > Undo levels (Model+).
7.1.3Improved command: 'LoadPDB' allows to configure the path of a local PDB installation, click File > Load > PDB file from local PDB.
7.1.2Improved command: The 'Lightsource' command now also configures ambient lighting and shadows, the 'Shadow' command is deprecated.
7.1.1New highlight: YASARA now has a newly styled look, that also adapts to your current operating system, see www.yasara.org/looks. Click Window > Style (Model+).
6.12.31Improved commands: 'LoadSce' and 'SaveSce' now also load/save the projection, antialiasing, point & line appearance, fog and hbond colors, lighting parameters, surface parameters and cell boundary.
6.12.30Improved command: 'WinFont' now allows to choose between 6 different fonts, click Window > Font.
6.12.29Improved command: The 'HUD' command can show the head up display with an antialiased font, click Window > HUD > Antialiasing.
6.12.28Improved command: The 'ConsolePar' command can show the console with an antialiased font, click Window > Console > Parameters.
6.12.27Improved command: 'AnimateWin' command supports a new 'tilting' animation, click Window > Animation > Tilt.
6.12.26Improved plugins: The 'CheckBoxMenu' allows to set the default checkbox states by appending '(Checked)' to the box text.
6.12.19New feature: While a window is on screen (e.g. to interactively adjust dihedral angles), the scene can still be moved and rotated by holding down a mouse button outside the window.
6.12.17New feature: When specifying a macro as a command line argument, it is now possible to add variables, see Essentials > The command line parameters.
6.12.13Improved selection language: The 'with bond angles to' operator analyzes second neighbors in the molecule. Read Selections > Selections can be combined.. > The 'with <>X bond angles to' operator.
6.12.10Improved typing and force field parameter assignment for small molecules.
6.12.8Improved commands: Load* and Save* now support many more OpenBabel based fileformats.
6.12.3New highlight: The 'Processors' command activates support for multiple CPUs, heavily speeding up molecular simulations, see www.yasara.org/parallelmd and click Options > Processors (Dynamics+).
6.12.1Improved commands: 'Fix' and 'Free' are now included in the undo/redo history.
6.11.29New feature: Up to four bond lengths, bond angles and bond dihedrals can now be changed together interactively. Mark two atoms, then click Geometry > Bond .. in the atom context menu. For more details, check the 'Distance', 'Angle' and 'Dihedral' commands (Model+).
6.11.27Improved support for Windows Vista.
6.11.24Improved command: 'LoadPDB' accepts a 'Model' parameter to load only one model from an NMR bundle.
6.11.22New command: 'SwapBond' changes an existing bond order, the use of 'AddBond' for this purpose is deprecated. Click Edit > Swap > Bond.
6.11.21Improved Yanaconda macro language: the 'join' function concatenates a list to a single weak string.
6.11.20Improved selection language: the 'without contribution to .. surface' selects buried residues that do not contribute to a certain surface.
6.11.11New command: 'MoveMesh' moves a polygon mesh in the local coordinate system to facilitate rotations around certain points.
6.11.5New feature: YASARA's assembly language core now supports the SSE3 instruction set found in PentiumIV Prescott, Athlon64 Venice, Opteron 90nm and newer CPUs. On AMD Opteron, the speedup for MD simulations is ~10%. Make sure to either select 'Many' or a CPU architecture with SSE3 on the download page.
6.11.3Improved command: 'Temp' accepts a new 'reassign' parameter to toggle the reassignment of atom velocities according to a Maxwell-Boltzmann distribution.
6.11.1Improved command: 'LoadPDB' automatically adds missing CONECTs if the 'Correct' flag is set. Using LinkAtom is no longer needed.
6.10.30New example macro: md_refine.mcr refines a homology model and analyzes individual snapshots, check the docs at Recipes > Refine a homology model.
6.10.28Improved command: 'Link' does a better job ignoring bumps instead of assigning covalent bonds.
6.10.26Improved command: 'ListObj' now also lists those objects that do not contain atoms.
6.10.24New feature: The new parameter 'SetPar' of the 'ForceField' command allows to set optimal default simulation parameters, click Simulation > Force field (Dynamics+).
6.10.19Improved simulations: If the simulation cell includes only a small part of the protein, the simulation runs much faster now with (Y)AMBER force fields.
6.10.8New highlight: The 'Crystallize' command fills the unit cell with symmetry related copies of the selected object. Click Edit > Crystallize (Dynamics+).
6.10.4Improved macro language: the 'chr' function converts an ASCII number to a character string.
6.9.22New feature: Amino acid side-chains bound to ligands or metals are now shown when choosing one of the trace, ribbon or cartoon scene styles.
6.9.20Improved commands: 'LoadPDB' and 'SavePDB' preserve the crystallographic symmetry REMARK 290.
6.9.18New command: 'Compare' finds differences between atom and residue selections. Click Analyze > Compare.
6.8.19Improved command: 'NiceOri' can choose a nice orientation for the entire scene. Click Effects > Orientation > Set nicely for scene (Model+).
6.8.13Improved command: 'SwapRes' can swap nucleotides to Uridine and handle nucleotides like ATP or GDP.
6.8.6Improved command: 'BuildRes' supports a 'Center' flag to disable centering of the newly built residue.
6.8.1Improved command: 'SwapRes' keeps all useful side-chain dihedral angles to minimize reorientations (Model+).
6.7.25Improved command: 'RayTrace' supports a new 'Background' parameter to create transparent backgrounds.
6.7.15New highlight: The YAMBER3 force field provides another improvement in force field accuracy (Dynamics+).
6.7.10Improved command: 'SurfPar' can display the current surface parameters.
6.7.8Improved graphics: Lines are now drawn with antialiasing if requested (Window > Antialiasing) and supported by your OpenGL driver.
6.7.6Improved command: 'ColorPar' allows to choose all rainbow colors for the secondary structure elements. Click View > Color > Parameters > Secondary structure.
6.6.25Improved selection language: the 'with distance >X from' operators provide more intuitive results for 'Res', 'Mol' and 'Obj' selection types.
6.6.19New feature: MD simulations with solvents other than water are now much easier. Check the documentation of the commands 'FillCellObj' and 'PressureCtrl' (Dynamics+).
6.6.18New command: 'Mass' sums up atomic masses, click Analyze > Mass of.
6.6.17Improved command: FillCellObj allows to specify a density to easily fill the simulation cell with special solvents. Click Simulation > Fill cell with (Dynamics+).
6.6.16New command: 'SolvDensity' measures the density of any solvent, the 'WaterDensity' command is now deprecated.
6.6.12New feature: The current energies are displayed in the simulation HUD on the right side and can be quickly recalculated by pressing the key left to '1'.
6.6.11Improved commands: 'CorrectCis' and 'CorrectIso' can now also correct unusual amino acids.
6.6.10New feature: Having grabbed a single object for movement, it is now possible to grab the entire scene again by clicking a second time on the object name in the top right HUD.
6.6.9Improved commands: 'Sup' and 'RMSD' can now perform full matching of atom and residue names.
6.6.6New highlight: YASARA can now calculate force field energies individually for objects, molecules, residues and atoms. This makes it easy to localize regions of high-energy. Click Analyze > Energy (Dynamics+).
6.5.29New feature: The commands 'Sup' and 'RMSD' can now also shuffle atoms around within a residue to easily superpose molecules with different atom orders.
6.5.20New default: The 'CorrectCis' command does not correct cis-prolines by default now.
6.5.15Improved command: 'TransformObj' supports a flag to keep the global object position after transformation of atom coordinates. This is now the default.
6.5.7New command: 'RenumberObj' reorders the objects in the scene, helpful to close gaps in the HUD if objects have been deleted. Click Edit > Renumber > Objects.
6.4.30Improved command: 'Clean' adds cysteine bridges between close CYS SG atoms.
6.4.29New feature: Atoms causing an error message are now automatically highlighted.
6.4.28Improved command: 'LoadPDB' supports a 'correct' option to automatically delete unusually long CONECT bonds.
6.4.27Improved command: 'Clean' detects alternate conformations of entire molecules put on top of each other and deletes the one with the lower occupancy.
6.4.26Improved commands: 'LoadPDB' and 'Clean' detect and correct shifted atom names.
6.4.25Improved commands: Virtually all YASARA commands now support compression when reading or writing files whose names end with '.gz'.
6.4.23Improved commands: 'Sup' and 'RMSD' display a warning when trying to superpose atoms with different names.
6.4.21Improved plugin: The PDBFinder2 interface retrieves data from a new server and better handles proteins with chain-breaks. Click Analyze > PDBFinder2 properties.
6.4.15Improved command: 'Clean' sorts backbone and side-chain atoms within each residue.
6.4.9Improved commands: 'BuildRes', 'AddRes' and 'SwapRes' can now select specific Asp, Glu, His and Cys protonation states via special residue names.
6.4.8Improved command: 'Tabulate' now also adds string return values to a table, e.g. 'Tabulate NameRes all' tabulates all residue names.
6.4.7Improved experiment: The minimization checks for regions with strong bumps and performs a local steepest descent minimization without electrostatics first to avoid nuclear fusion caused by Coulomb attraction exceeding VdW repulsion.
6.4.5Improved command: 'Energy' explicitly returns a planarity energy also for the NOVA force field to identify severe planarity problems. Total NOVA energies therefore change a bit.
6.4.3New feature: YASARA now calculates solvent accessible surfaces using optimized 'effective' Van der Waals radii that implicitly consider hydrogen bonds. For best results, the probe radius should be set to 1.4 A (click View > Show surface > Parameters).
6.3.27Improved command: 'List' supports a new 'Format' parameter to also get names in specific formats, not only numbers.
6.3.26New commands: 'PosMol' and 'PosRes' set and get the position of the geometric center of molecules and residues, click Effects > Position.
6.3.25Improved command: 'SecStrRes' returns the secondary structure as a list of character strings 'H','E','T' and 'C'. Numerical codes are deprecated.
6.3.24New highlight: the commands 'GroupDistance', 'GroupAngle' and 'GroupDihedral' calculate the distance between geometric centers and the angles between lines and planes optimally fit through groups of atoms, e.g. the angles between two helices or phenyl rings. Click Analyze > Geometry (Model+).
6.3.23Improved command: 'SaveMOL2' stays closer to the file format when saving proteins.
6.3.20New feature: The 'Surf' command supports a new 'unit' parameter to calculate surface areas per molecule, residue or atom.
6.3.16Improved command: 'Color' accepts multiple sequence alignment also in FASTA format when coloring by sequence conservation.
6.2.12New command: 'Name' sets or gets the names of objects, molecules, residues and atoms. The 'Rename' command is now deprecated.
6.2.10New command: 'UnlabelDis' deletes distance labels between selected atoms. Click Effects > Unlabel > Distance.
6.2.7New workaround for flickering problems on Intel GMA 9xx graphics chips when running YASARA fullscreen.
6.2.5Improved command: When 'Raytrace'ing with outlines, black labels are excluded to allow proper labeling of schematic figures.
6.1.24Improved bond typing: A weighted average of bond length and bond angle deviations is now used to determine hybridization states.
6.1.23Improved command: 'SwapAtom' knows all standard (order dependent) bond lengths between organic elements and updates them accordingly.
6.1.22New feature: 'Check WaterPos' calculates normality Z-scores for water molecules to identify those at unlikely positions, e.g. a hydrophobic protein cavity. Click Analyze > Check (Dynamics+).
6.1.19Improved experiment: Neutralization uses an improved algorithm to avoid placing water molecules in cavities where a vacuum would be energetically more favorable.
6.1.17Improved macro language: the 'dirname' function extracts the directory name from a string.
6.1.15New improved algorithm to remove center-of-mass-motion from a simulation, solutes are now less likely to pass periodic boundaries, which makes visualization easier (Dynamics+).
6.1.14Improved command: 'Sim Pause' can now be used to pause a simulation after a given time. Click Simulation > Simulator > Pause in...
6.1.13Improved commands: 'Label' and 'Unlabel' are now restricted to create and delete labels of a given unit type. Click 'Effects > Unlabel > All above' to delete all labels at once.
6.1.12Improved commands: 'Sup' and 'RMSD' can determine the chemical equivalence of molecules with exotic atoms to minimize the RMSD via the 'flip' flag.
6.1.11Improved command: 'ForceField' allows to set the charge assignment scheme: AutoSMILES, AM1BCC or AM1 (for comparison and validation only).
6.1.10New feature: The 'AutoSMILES' algorithm automatically splits long aliphatic lipids that contain too many atoms for QM charge derivation (Dynamics+).
6.1.9Improved command: 'Clean' makes external single atoms bound to a residue part of this residue, e.g. three oxygens bound to Cys SG atoms.
6.1.8Improved command: 'Experiment' automatically cleans the soup in case hydrogens are missing, 'Neutralization' does a better job removing waters from the protein core.
6.1.7Improved command: 'Clean' deletes terminal residues with incomplete backbone, which are usually X-ray artifacts.
6.1.6Improved feature: automatic force field parameter assignment and QM optimization in water are now 6x faster in YASARA for Windows.
6.1.1New highlight: The 'AutoSMILES' algorithm fully automatically parameterizes organic molecules for simulation, including assignment of point charges by combining the high-throughput AM1BCC approach with a large SMILES-based library of optimal RESP charges, making it possible to run MD simulations of most PDB files at the touch of a button. Read www.yasara.org/autosmiles or Recipes > Running molecular dynamics simulations > Preparing the force field > Deriving new (Y)AMBER parameters (Dynamics+).
5.12.31Improved typing of double bonds outside rings.
5.12.30Improved selection language: the 'Charge' operator allows to select by net charge. Look at the end of the 'Belongs to or has' list or read Selections > Additional selection types > Charge.
5.12.29New help movie: 'Simulation and quantum mechanics of small molecules' introduces fractional bond orders and pH dependency, shows how to build and simulate small molecules, and how to use quantum mechanics to optimize geometries and compare tautomers. Click Help > Play help movie > Simulation and QM of small molecules. (Dynamics+)
5.12.28Improved command: 'LabelDis' accepts a new 'bound flag' to label only distances between bound atoms.
5.12.27New highlight: The 'QuantumMechanics' command activates the semi-empirical MNDO, AM1 or PM3 quantum chemistry methods provided by the built-in YAPAC, a customized and validated derivative of MOPAC. Click Options > Quantum mechanics (Dynamics+).
5.12.26Improved command: 'Label' supports two new format options 'ATOMTYPE' and 'ATOMCHARGE' to label with atom type and charge respectively.
5.12.25New feature: 'pH' sets the implicit solvent model used in quantum chemistry calculations, either none when working in vacuo or COSMO by A.Klamt when working in solution.
5.12.24Improved command: 'Sim Init' automatically adds springs to enforce virtual bonds to metal ions (i.e. headless arrows added by ShowArrow or by CONECT records in the original PDB file) (Dynamics+).
5.12.23New highlight: The 'Optimize' command tunes the geometry of molecules containing up to ~100 atoms using semi-empirical quantum chemistry. Click Edit > Optimize.
5.12.22Improved command: 'AddBond' accepts a new 'bound flag' to modify only existing bonds. Click Edit > Add > Bond.
5.12.21New command: 'FormEnergy' calculates the heat of formation using semi-empirical quantum chemistry. Click Analyze > Energy > Formation.
5.12.20Improved command: 'AutoMoveImage' supports two ways of repeating the automatic image movement: 'Cycle=MoveBack' and 'Cycle=JumpBack'.
5.12.19New command: 'TypeAtom' retrieves the currently assigned force field atom types, for example to label atoms accordingly.
5.12.18Improved command: When importing molecules with OpenBabel using 'Load*', the 'Resonate' flag allows to automatically replace alternating single/double bonds with the proper resonance form.
5.12.16Improved command: 'Clean' replaces seleno-methionine with methionine and deletes NMR dummy atoms (element 0).
5.12.15New highlight: The new General AMBER Force Field (GAFF) provides force field parameters for any organic molecule.
5.12.14Improved typing of bonds and handling of alternate atoms.
5.12.10New WHAT IF released as part of the Twinset. WHAT IF's homology modeling module now also works in the Twinset.
5.12.7Improved handling of cyclic peptides: Traces, tubes and ribbons are now drawn without a gap, provided that the cyclic peptide bond is indicated with a 'CONECT' in the PDB file.
5.12.3New command: 'KekulizeBond' converts resonance bonds with fractional bond orders to alternating single/double bonds. Click Edit > Adjust bond orders > Kekulize bond.
5.12.2Improved command: 'RMSD' accepts a 'flip' flag like 'Sup' to minimize the calculated RMSD by flipping chemically equivalent atoms.
5.12.1New command: 'ResonateBond' converts alternating single/double bonds to the proper resonance form. Click Edit > Adjust bond orders > Resonate bond.
5.11.26Improved command: 'ShowTrace' displays a trace also for Calpha only proteins when you press <F4>.
5.11.25Improved command: 'Clean' detects residues with missing bonds and invokes 'Link' to find them before adding hydrogens.
5.11.24Improved command: 'LoadPDB' automatically searches and types links in standard residues with non-standard atom names.
5.11.23New workaround for a new ATI Radeon OpenGL Linux driver bug (missing secondary structure), updated installation hints at Troubleshooting > YASARA runs slowly > You are running Linux with an ATI Radeon.
5.11.22Improved command: 'Link' uses a new algorithm to find also large numbers of bonds quickly.
5.11.20Improved command: The tubes and ribbon created by 'ShowSecStr' stay correct when the protein crosses a periodic boundary.
5.11.19Improved command: 'PosAtom' can now set and get the mean position of an atom selection.
5.11.18New highlight: The improved 'TypeBond' command employs a new algorithm combining graph theory with chemical knowledge on valence ambiguities and preferred tautomers to type complicated hetero-polycycles, e.g. in PDB file ligands. See www.yasara.org/typing or click Edit > Type bonds.
5.11.14Improved command: 'LoadPDB' provides special support for ancient but still official PDB files with weird atom names.
5.11.10Improved plugin: the OpenOffice Impress import filter now supports OpenOffice 2.0. Click Options > Macro & movie > Import movie
5.11.6New Yanaconda function: 'ord' returns the summed ASCII code of the given string
5.11.4Improved command: 'Dihedral' can now change improper dihedrals, also interactively from the atom context menu.
5.11.3New command: 'Dipole' calculates the electric dipole moment. Click Analyze > Dipole moment of (Dynamics+).
5.11.2Improved selection language: the operator 'within sequence' selects units belonging to a given sequence, e.g. ColorRes Lys within sequence Arg Lys Phe,yellow.
5.11.1New workaround for a Mandriva Linux 2006 AMD64 problem, which is lacking the library 'libncurses'.
5.10.15Improved selection language: Single or double quotes can be used to span unusual atom/residue/object names with special characters like spaces.
5.10.9New highlight: Structural alignments using the CE, Multiprot and Sheba methods are available for Windows and Linux. Click Analyze > Align. Contributed by Emmanuel Bettler and Mikael Roche.
5.10.8Improved command: 'BuildAtom' allows to define the position of the new atom, which helps to place dummy atoms e.g. in the center of a phenly ring to measure distances.
5.10.7New command: 'pKaRes' assigns pKa values to selected residues that override the predictions made during the neutralization experiment. Click Options > Residue pKa.
5.10.5Improved command: 'SwapRes' can swap residues to Uracil and keeps the chi1 dihedral intact.
5.10.1New highlight: The commands 'ShowSphere', 'ShowBox' and 'ShowCone' display solid spheres, ellipsoids, cubes, boxes, cylinders, cones, prisms and pyramids. Click Effects > Show solid. Click Help > Play help movie > 'Buckynut Island' for a demonstration (Model+, download from www.yasara.org/movies in YASARA View).
5.9.25New Yanaconda function: 'trunc' returns the integer part of a number, rounded towards zero.
5.9.18New command: 'MoveMesh' translates a polygon mesh in its local coordinate system to allow off-center rotations. Click Effects > Move > Mesh.
5.9.15New command: 'SearchDoc' googles the YASARA documentation. Click Help > Search documentation.
5.9.10Improved experiment: Neutralize does a better job at keeping original water molecules very close to metal ions instead of replacing them with newly added ones.
5.9.6Improved command: 'Link' now uses the atomic bond radii and an 'allowed deviation' parameter to find bonds. The bond orders are also assigned automatically.
5.9.2New highlight: The 'pH' command sets the default pH, YASARA now has extensive knowledge about pH dependent bond orders and protonation patters of organic molecules and assigns bond orders and hydrogen atoms according to the chosen pH. Read Commands > Options > Default pH (Model+).
5.8.30Improved command: 'SampleLoop' allows to select the preferred secondary structure.
5.8.24Improved command: 'LoadPDB' automatically topologyfies ligands in PDB files and assigns bond orders.
5.8.21New highlight: The 'TypeBond' command analyzes any organic molecule and assigns fractional bond orders, making it easy to add hydrogen atoms. It is no longer required to manually add topologies for unknown molecules to yasara.def. Read Commands > Edit > Bonds > TypeBonds.
5.8.19Improved command: 'AddHyd' contains a new 'update' parameter to adjust bond orders to the newly added hydrogens.
5.8.15New feature: Bonds to metals (which are not considered real bonds by MD force fields) are converted to virtual bonds and shown as cylinders when reading/writing PDB files. Read Commands > Edit > Bonds > AddBond.
5.8.10Improved command: 'AddBond' now accepts fractional bond orders to express resonance effects and a parameter to update hydrogens. Read Commands > Edit > Bonds > AddBond.
5.8.2New highlight: The POVRay interface has been heavily improved and now includes fog, textures (MakeImageObj), fore- and background images (ShowImage), exact background colors and the ability to add outlines for comic style graphics. Read Commands > File > Screenshots > Raytrace.
5.8.1Improved command: 'Color' accepts RGB atom colors and finds the closest matching color in YASARA's own color scheme.
5.7.30New command: 'SaveMacro' creates a macro that restores selected parts of YASARA's current state: scene, visualization parameters, images, simulation parameters, window parameters. Click Options > Macro & Movie > Save macro.
5.7.29Improved command: 'PressCtrl' can exclude axes from rescaling.
5.7.28New highlight: The 'Projection' command toggles between perspective and parallel projection. Click View > Projection.
5.7.21Improved command: 'RayTrace' and 'SavePOV' now also include the black outline of the comic atom texture (View > Atom appearance > Texture > Comic).
5.7.20Improved command: 'AddHyd' automatically corrects bond orders and atom names of carboxyl groups.
5.7.19Improved command: 'SaveXTC' and 'LoadXTC' have improved LFS support to handle trajectories larger than 2 GB in Linux.
5.7.18New highlight: A new plugin automatically converts OpenOffice/PowerPoint presentations to YASARA movies, which makes it easy to augment them with hi-quality molecular animations. Read Recipes > Create your own YASARA movies > Movies can be imported from OpenOffice and PowerPoint (Model+).
5.7.17Improved command: 'Clean' corrects bond orders and atom names of carboxyl groups.
5.6.30Improved command: 'AddBond' now gained the 'UpdateHyd' option to suppress the update of hydrogen atoms.
5.6.29Improved plugins: Error reports and update requests now function without having to add an email server in plg/reporter.cnf
5.6.23Improved command: 'ScaleForce Planarity' now includes not only improper dihedrals, but also normal dihedrals in planar systems.
5.6.21Improved multi-monitor support: Set 'CorrectWin' in yasara.ini to 0 to disable the window size correction, which helps if the YASARA window is on monitor 2.
5.6.16Improved command: 'WaterDensity' works better in non-periodic cells, where the vacuum layer between cell wall and atoms (caused by repulsive wall forces) is now excluded from the density calculation.
5.6.14Improved command: 'PressureCtrl' now rescales only the simulation cell and not the atom coordinates if there are atoms outside a non-periodic cell.
5.5.25Improved command: 'BuildMol' now also reads FASTA sequences to build a linear peptide chain (Model+).
5.5.22New highlight: The 'Volume' command calculates VdW, molecular and solvent accessible volumes. Click Analyze > Volume of (Model+).
5.5.20New command: 'ScaleForce' scales bond, angle, dihedral, planarity and non-bonded forces during a simulation. Click Simulation > Scale forces. The commands ScaleBSFC and ScaleNBI are now deprecated (Dynamics+).
5.5.18New feature: Yanaconda macros can contain 'include' statements to include other macros (read Macros > Yanaconda macros can include each other).
5.5.16Improved commands: 'CorrectIso' and 'CorrectCis' use a new dihedral-angle based algorithm to enforce correct stereochemistry during high temperature simulations.
5.5.13New command: 'NiceOri' orients an object nicely (along its major axes). Click Effects > Orientation > Set nicely for object (Model+).
5.5.12Improved command: 'CorrectCis' allows to exclude proline residues from cis-peptide bond correction.
5.5.9Improved command: 'Clean' swaps methylene hydogens to match PDB/XPLOR conventions for stereoassigned NOEs.
5.5.1Improved force field parameter assignment for DNA/RNA bases.
5.4.5New IMPORTANT feature: YASARA's internal force field representation has been changed. If you modified force fields, recompile them with 'yasara -upd' now.
5.3.31Improved command: OpenBabel export with 'Save*' now offers a 'transform' option to restore original atom coordinates and a 'nameformat' option to choose among different atom naming conventions. A few OpenBabel for Windows issues have been fixed.
5.3.30New feature: the order of covalent bonds can be shown in Ball&Stick style with 'ColorBonds Order'.
5.3.28Improved command: 'SavePDB' allows to select the YASARA PDB format variant in addition to PDB standard and Xplor.
5.3.20New IMPORTANT feature: The conventions for triclinic (=non-rectangular) simulation cells have been changed to match the PDB format. .sce or .sim files with non-rectangular cells have to be converted. Please update YASARA Dynamics (as a bonus, the PME code runs a bit faster now).
5.2.28Improved detection of unusual DNA/RNA bases to display them as part of the DNA/RNA backbone.
5.2.26New command: 'SecStr' assigns a custom secondary structure and analyzes the secondary structure content. The commands 'ShowSec' and 'HideSec' changed their names to 'ShowSecStr' and 'HideSecStr'. Click Analyze > Secondary structure of.
5.2.24New feature: OpenBabel has been updated to version 1.100.2, the command 'Save*' now also exports atom charges assigned by the current force field. Click File > Save as > Other fileformat.
5.2.17Improved command: If there are residues with alternate locations, 'Clean' keeps only the one with highest occupancy.
5.2.13New highlight: The 'Check' command performs 20+ different WHAT_CHECKs of protein structures: bonds, angles, torsions, omega angle, Ramachandran plot, side-chain rotamers, proline rings, chirality, planarity, backbone conformation, peptide-plane flips, bumps, 3D packing quality, inside-outside distribution, unsatisfied H-bonds, flipped Asn/Gln/His side-chains, B-factors and atom occupancies. Click Analyze > Check (Twinset).
5.2.11New command: 'PointPar' sets the style and thickness of point/wireframe objects (ShowESP,ShowSimGrid,WHAT IF MolObjects). Click View > Point & line appearance.
5.2.9New highlight: The 'Align' command performs a structural alignment with the MOTIF algorithm. Click Analyze > Align (Twinset).
5.2.7Improved command: 'LoadPDB' now searches a local PDB automatically if 'PDBPath' is defined in yasara.ini
5.2.5New highlight: The 'OptHyd' command optimizes the hydrogen bonding network and flips Asn/Gln/His side-chains if that improves the network. Click Edit > Add > hydrogens to: object & optimize (Twinset).
5.2.3Improved command: 'SaveMPG' now uses a quality instead of bitrate setting, which avoids encoding failures with some animations.
5.2.1New highlight: The 'Regularize' command optimizes bond lengths, angles and chirality. Click Edit > Geometry > Regularize (Twinset).
5.1.30Improved commands: 'Raytrace' and 'SavePOV' now also work in console mode, e.g. on a web-server creating molecular graphics with YASARA.
5.1.28New highlight: The 'ShowRota' command shows the backbone dependent rotamer distribution for selected residues. Click Analyze > Rotamers (Twinset).
5.1.21Improved command: 'ScreenSize' also works in console mode and defines the aspect ratio of ray-traced output.
5.1.20Improved selection language: the 'Property' operator selects atoms by their property value.
5.1.19Improved command: 'ColorPar' can change the default color range for atom properties.
5.1.18New command: 'Prop' gets and sets the new atomic property value that maps to WHAT IF's 'atomic value' and becomes very helpful in the Twinset.
5.1.17Improved command: 'PosAtom' now also gets/sets atom positions in the global coordinate system.
5.1.12Improved command: 'SaveXTC' wraps molecules around periodic boundaries to avoid saving 'broken' ones with bonds that span the simulation cell.
5.1.11Improved command: 'TransferObj' can now also correctly transfer static surfaces and similar geometry to another coordinate system.
5.1.10Improved commands: 'LoadSim' and 'LoadXTC' now have an option to disable secondary structure reassignment.
5.1.9Improved commands: 'RayTrace' and 'SaveMPG' allow to disable the POVRay window.
5.1.5New highlight: The 'SaveMPG' command creates MPEG movies, plain or ray-traced. Click File > Save as > MPEG movie (Model+).
4.12.31Improved support for resolution independent movies. See Recipes > Create movies > The look of the movie.
4.12.29Improved command: 'LoadXTC' applies the transformation history of the target object to avoid unwanted shifts.
4.12.25New highlight: The 'SolvEnergy' command calculates solvation energies using a fast boundary element approach. Click Analyze > Energy > Solvation (Dynamics+).
4.12.19Improved commands: 'AddHyd' and 'Clean' make better choices when inventing hydrogen names.
4.12.17Improved command: 'Label' supports new format components: OBJNAME,OBJNUM,ATOMNAME and ATOMNUM. Click Effects > Label.
4.12.15New highlight: YASARA now supports copy&paste, the console at the bottom has been heavily improved with history and selections. Click Essentials > The keys and mouse buttons > Using the console.
4.12.13Improved commands: 'ListCon' and 'ListHBo' now also return the selected units, e.g. atomlist()=ListConAtom Mol A,Mol B.
4.12.11New command: ConsolePar changes the size and font of the extended console (press <Space> twice to bring it up). Click Window > Console > Parameters.
4.12.9Improved selection operators: 'with distance' and 'with atoms among' now consider periodic boundaries during a simulation.
4.12.7Improved experiment: Neutralization does a better job at reaching the requested water density.
4.11.30Improved secondary structure assignment for double beta bulges.
4.11.29Improved support for hires notebook screens up to 1680x1050.
4.11.24New feature: hydrogen bonds can now inherit the color of the bound atoms, click View > Color > Hydrogen bonds.
4.11.23Improved quad-buffered stereo and ray-tracing of stereo images.
4.11.14New command: 'FlipTab' flips a pair of table axes (columns, rows, pages). Click Options > Tables > Flip.
4.11.13New feature: YASARA can now work with 250 objects at the same time (Model+)
4.11.12Improved commands: 'Sup' and 'RMSD' calculate all permutations if several objects are selected and support a 'unit' parameter. Averages and standard deviations are no longer returned.
4.11.11New Yanaconda functions: 'mean' and 'stddev' calculate the average and standard deviation of a list.
4.11.10Improved command: 'Center' now also allows to center on atoms, residues and molecules. E.g. click Center > Atom in the atom context menu.
4.11.9New highlight: Tables have been reimplemented and heavily improved. They can now be one-, two- or three-dimensional. The 'ShowTab' command visualizes tables using various styles. Click Options > Table > Show.
4.11.8New command: 'MakeTab' creates a new table with one to three dimensions. Click Options > Table > Make.
4.11.7New command: 'DelTab' deletes tables. Click Options > Table > Delete.
4.11.7New command: 'Tab' sets or gets table cells, columns, rows, pages and entire tables. Click Options > Table > Set/get cells.
4.11.6New command: 'Tabulate' adds new cells to a growing table and replaces the deprecated 'AddTab' command.
4.11.6New command: 'SelectTab' selects a table for use by the new 'Tabulate' command. Click Options > Table > Tabulate.
4.11.5New command: 'LoadTab' loads a table in plain text format from disk. Click Options > Table > Load.
4.11.5Improved command: SaveTab allows to select a table, which supports the forthcoming release of heavily improved tables. This is one of the rare changes that are not backwards compatible but required for consistency.
4.11.4Improved plugin: An interactive check for updates is available, click Help > Check for update. Contributed by Emmanuel Bettler.
4.11.3Improved command: 'Link' now also assigns the order of covalent bonds for residues with topology information in yasara.def.
4.11.1Improved command: 'FillCellObj' allows to define the maximum allowed sum of bumps.
4.10.31New Yanaconda functions: 'sum' and 'average' sum up list elements and calculate the average.
4.10.30Improved windows: all load/save dialogs have been enlarged so that long filenames are easier to read.
4.10.29New command: 'Radius' calculates Van der Waals radii. Click Analyze > Radius of.
4.10.28Improved commands: 'Occup' and 'BFactor' now allow to set unusual atom occupancies and B-factors from -99.99 to 999.99 for programs that expect different data like charges and radii in these columns of the PDB file.
4.10.24New feature: YASARA now reads gzip compressed files (.gz extension) transparently. Time to compress your local copy of the PDB?
4.10.21New command: 'MouseWheel' assigns one of four functions to the mouse wheel. Click Window > Mouse wheel command.
4.10.20New command: 'SavePower' enters a special power saving mode for notebooks running on battery. Click Window > Save power.
4.10.19New command: 'WinFont' changes the fonts used by YASARA's window manager. Click Window > Font.
4.10.16New highlight: The 'FirstSurf' command combined with the new selection operators 'with distance from surface' and 'with contribution to surface' enables very flexible surface analysis. See Commands > Analyze > Surfaces > FirstSurf (Model+).
4.10.15Improved command: 'Color' now returns the colors of the selected atoms: collist() = ColorAtom Obj 1crn
4.10.14New Yanaconda feature: You can now loop over the content of a file, e.g. a list of PDB IDs: for id in file /home/id.txt, see Macros > There a four types of loops > Loops can run over a list.
4.10.13Improved secondary structure assignment for some beta bulges.
4.10.4New feature: 'yasara -txt' runs the program in plain text mode, see Essentials > Running YASARA in special environments > Running without graphics.
4.10.3New movie available: 'PhD defence', a summary about the technology and science behind YASARA at www.yasara.org/multimedia.
4.10.2Improved filename handling: loading a file with missing extension is now possible, and the working directory is searched before any subdirectories.
4.10.1New feature: The mouse wheel scrolls through lists and selects the previous and next atoms.
4.8.31Improved command: 'AddSpring' can now add springs to atoms without intramolecular interactions (ions).
4.8.27Improved selection language: 'LocalX|Y|Z' and 'GlobalX|Y|Z' allow to select atoms by their positions. Selections by 'BFactor' and 'Occupancy' are now also possible.
4.8.26New highlight: a Linux plugin to create MPEG movies and animated GIFs is available. Click File > Save as > MPEG/GIF movie. Contributed by Emmanuel Bettler.
4.8.24Improved command: 'SwapRes' can now also swap non-standard amino acids like seleno-methionine.
4.8.22New highlight: A structural alignment plugin using SHEBA (by J.Jung & B.Lee) is available. Click Analyze > Superpose > Objects automatically (Linux only). Contributed by Mikael Roche & Emmanuel Bettler.
4.8.18New command: 'ColorPar' sets various default color schemes for chemical elements, secondary structure, B-factors. Click View > Color > Parameters.
4.8.18Improved command: 'Zoom' now also considers the visibility of surfaces when fitting atoms on the screen and is much faster for large proteins.
4.8.17Improved command: 'RayTrace' does a better job putting special textures (selected with 'AtomTexture') on the atoms
4.8.13New command: 'PrintHUD' allows plugins to print to YASARA's head-up-display and is now also available in YASARA View.
4.8.13New highlight: Several improvements make building small molecules very easy. Get an update and watch the new help movie 'Building small molecules' (Model+).
4.8.12Improved command: 'AddBond' now automatically adapts the hydrogen atoms (if the object contains any) to the new bond order.
4.8.8New feature: Python plugins can be run directly from the command line: yasara MyPlugin.py MyRequest ('MyRequest' is sent to the plugin, no selections are available).
4.8.8Improved plugin: The PDBFinder2 plugin to analyze proteins now uses the BioASP server at www.bioasp.nl
4.8.6New command: 'AddHydAtom' allows to add hydrogens to individual atoms, e.g. to quickly force Histidine protonation.
4.8.3Improved command: 'AddHyd' is orders of magnitude faster now and places aliphatic hydrogens more intelligently.
4.7.21Improved command: 'FillCellWater' and 'Experiment Neutralize' are now less likely to place waters inside homology models with a loose core packing. The second parameter had to be changed. Post-processing steps to delete these waters are not absolutely required anymore.
4.7.18New Python plugin command: yasara.Finish() synchronizes the plugin with YASARA, more info at Plugins > Python plugins run in a separate thread
4.7.10Improved sequence selector: atoms behind it are clickable while the sequence selector is transparent.
4.7.4New highlight: A 'neutralizing plasma' allows to run Particle Mesh Ewald simulations also with non-neutral simulation cells. Simulation algorithms and energy calculations have been improved and run a bit faster now. Update now!
4.7.3Improved command: 'Surf' calculates surface areas 0.1% more accurately.
4.6.25Renumbering residues is now restricted to the 'RenumberRes' command. To renumber the residues in object 1crn, type 'RenumberRes Obj 1crn'. The shortcut 'RenumberObj 1crn' is deprecated.
4.6.18New movie feature: When a movie ends (or you click on Options > Macro & Movie > Stop), the scene including background colors+working directory is restored. To avoid that, run the movie as a macro.
4.6.17New command: 'ShowCom' opens the documentation for a given command in the browser.
4.6.16Improved command: The default Calpha color 'cyan' is now passed on to the ribbon/tubes/cartoons if all backbone atoms are cyan, not only if all residue atoms are cyan.
4.6.15New command: 'ShowDoc' opens the documentation in a browser window.
4.6.14Improved commands: During a simulation, static surface objects ('ShowSurf') and calculated surface areas ('Surf') consider all objects simultaneously.
4.6.7Improved command: 'CenterAll' centers all objects together, which keeps the superposition intact after loading multiple PDB files with centering disabled.
4.6.5Improved command: 'LoadPDB' handles incorrect/single-sided CONECT records.
4.6.1Improved commands: 'AddHyd' and 'Clean' now do a better job when working with alternate atoms and Val/Leu residues with swapped CG/CD atom names.
4.5.20New highlight: Support for 3DConnexion input devices has been added (Linux only for now). Click Options > Input devices to adjust the settings (Model+).
4.5.19New commands: 'GrabNext' and 'GrabPrev' grab the next and previous object for movement with mouse or 3DConnexion controller. Helpful when assigned to 3DConnexion controller buttons (Model+).
4.5.18Improved command: 'Clean' now automatically deletes bonds to cations, which may not be present during simulations.
4.5.17New optimized algorithms for several tasks that became bottle-necks when working with giant structures (300000 atoms). Many things run 100x faster now. See also the hints at Essentials > Working with extremely large structures.
4.5.12Improved support for NFS mounted multi-user installations: In the docs, click Essentials > Running YASARA in special environments.
4.5.12New release of the YASARA Models@Home distributed computing system with support for Redhat 9, Fedora Core, Mandrake 9, Windows XP.
4.5.11New highlight: Three new surface movies available from www.yasara.org/movies: Introduction, Environments and Electrostatics.
4.5.11Improved command: 'CountObj' now counts all objects, not just those with atoms.
4.5.10New highlight: The 'ShowSurf' command shows Van der Waals, molecular and solvent accessible surfaces, either static or dynamically updated.
4.5.9Improved command: 'MarkAtom' can now mark up to four atoms.
4.5.8New highlight: The 'ColorSurf' command assigns surface colors and transparency, options include coloring by atom and electrostatic potential.
4.5.7Improved selection language: 'with <>X bonds to' allows to select by the number of bound atoms.
4.5.6New highlight: The 'SurfPar' command sets the surface resolution and activates an interface to Michel Sanner's MSMS program which calculates analytic molecular surfaces.
4.5.4New highlight: The 'Surf' command allows to calculate VdW, molecular and solvent accessible surface areas (YASARA Model+).
4.5.3Improved handling of unusual amino acids: even those forgotten in the official PDB hetgroup dictionary are recognized correctly.
4.5.3New highlight: The 'AddEnv' and 'RemoveEnv' commands allow to define surface environments to analyze partial surfaces (YASARA Model+).
4.5.2Improved experiment: Minimization converges faster now.
4.5.1Improved selection language: 'visible' and '!visible' allow to select (in)visible atoms.
4.4.30New Yanaconda operator: Like in Python, '//' performs a division with truncation of the result's fractional part, e.g. 3//2 = 0
4.4.29Improved logs: Specifying a filename with .log extension as a command line argument will automatically record a log.
4.4.28Improved command: Logs recorded with 'RecordLog' are now flushed continuously and do not lag behind.
4.4.25New Yanaconda function: 'onein' returns a random list element.
4.4.15Improved command: 'Clear' now also clears the 'Tabulate'/'SaveTab' table. Use 'Del' instead of 'Clear' when adding values to a table.
4.4.14Improved command: 'Tabulate' now accepts an arbitrary number of values to add to a table.
4.4.12New command: 'SpeedUp' allows to toggle the speedup of movements when graphics are slow
4.4.9Improved documentation: Click Commands > Index to get an alphabetic list of all YASARA commands
4.4.7Improved installation: In Linux, you can now install YASARA as user A (e.g. 'root') and then work as user 'B' as long as you run it once as user 'A'.
4.4.3Improved Yanaconda macro language: up to 1000 times faster (better list handling, reduced printout in the console)
4.4.3Improved command: 'AddObj' returns the numbers of the first and last atom in the newly added object, e.g. first,last=AddObj 7
4.4.2Improved command: 'SplitObj' and 'OligomerizeObj' return a list of created objects, e.g. objlist()=SplitObj 5
4.4.2New Yanaconda feature: iterate over a list, e.g. selection()=ListAtom CA / for atom in selection
4.4.1Improved command: 'ListAtom' and 'ListObj' return a list of atom and object numbers.
4.4.1New Yanaconda feature: Assign the return values of YASARA commands to a list, e.g. mylist()=ListAtom CA
4.4.1Improved command: 'MakeImageObj' returns the number of the created image.
4.3.26Improved help movies: the 'OnError Continue' command makes sure that they will not stop if you make an error.
4.3.16New ATI Radeon Linux HOWTO (click Troubleshooting>YASARA runs slowly), workaround for a Radeon Linux driver bug in 'ShowMessage'.
4.3.14New highlight: A plugin for Bert de Groot's CONCOORD program allows to quickly sample conformational space and analyze protein flexibility. Click Edit > Sample.
4.3.14New Yanaconda functions: 'min MyList' and 'max MyList' return the smallest and largest list element.
4.3.13Improved command: 'Span' can now also determine the first and last residue number in a selection
4.3.13New command: 'BFactor' gets and sets the BFactor.
4.3.13Improved command: 'Temp' now also returns the current simulation temperature (YASARA Dynamics+)
4.3.12New command: 'Charge' gets and sets the net charge. The old command 'NetCharge' is now deprectated (YASARA Dynamics+)
4.3.12Improved command: 'Color' can now color by atom occupancy.
4.3.12New command: 'Occup' gets and sets the atom occupancy.
4.3.1Improved plugin support: 'NumberInputMenu[1-6]' allows to input 1 to 6 numbers and pass them to the plugin.
4.2.27Improved commands: 'LoadSce', 'LoadPDB' and several other commands are now much faster for large files.
4.2.15Workaround for an ATI Radeon Linux driver bug that caused color problems and showed random triangles (verified for fglrx 4.3.0-3.7.0 and Radeon 9600Pro)
4.2.14New Yanaconda functions: 'sqr X' function returns X*X, 'cube X' function returns X*X*X
4.2.11New command: 'Transfer' an object to the coordinate system of another object (e.g. if you moved one of two superposed objects away and want to get it back).
4.2.1Improved command: 'AtomSize' can now freely change the atom sizes, which is the same as moving the near clipping plane. Helpful when cutting surfaces open.
4.2.1Inconvenience solved: Showing just the side-chain and CA atom (e.g. in a ribbon) is now trivial (click on 'Show atoms').
4.1.25Improved pKa prediction accuracy in the 'Neutralization' experiment (YASARA Dynamics+)
4.1.15Workaround for a SiS OpenGL driver bug that crashed YASARA (verified for SiS 650M chipset)
3.12.24New Yanaconda functions: 'abs' function returns absolute values, 'sign' returns the sign (-1,0 or 1)
3.12.23Improved command: 'Clean' automatically corrects CG/CD atoms in Val/Leu that got swapped.
3.12.21Improved secondary structure assignment for wrong structures with lots of bumps.
3.12.18New command: 'Span' allows to determine the first and last atom or object spanning a selection. Very useful in macros.
3.12.11Command line arguments that do not end in .mcr, .yob, .sce are assumed to be PDB files and loaded instantly.
3.11.24Improved command: 'DelLink' now handles problems caused by incorrect PDB files with single-sided bonds.
3.11.23New plugin support: Python error messages are now displayed directly on screen including a traceback, also under Windows.
3.11.17New highlight: The 'SwapAtom' command now also adjusts the bond lengths, making building easier. E.g. to add a methyl group to a hydroxyl group, just swap the hydroxyl hydrogen to carbon.
3.11.16New command: 'UserInput' allows to disable disturbing user input during a non-interactive movie.
3.11.16Improved command: 'RayTrace' now also works for electrostatic potentials and simulation grids.
3.11.14New command: 'OnError' allows to handle errors in a running macro. This command replaces 'ErrorExit', which is now deprecated.
3.10.27New command: 'RequireVersion' allows to check if a minimum YASARA version is installed.
3.10.26New plugin support: Various workarounds for bugs in Windows solve some cases where Python plugins could not be run.
3.10.26New graphics engine: YASARA now runs better on old cards, especially those with Riva TNT chips.
3.10.25Improved command: 'Cell' now also returns the coordinates of the cell center and can be used to create non-centered cells (YASARA Dynamics+).
3.10.24New Yanaconda function: 'rnd' function returns random numbers, variables 'Linux' and 'Windows' define operating system.
3.10.20Improved command: 'MakeTextObj' returns the number of the created object (YASARA Model+).
3.10.19New highlight: Distances, angles and dihedrals can be changed interactively by marking up to four atoms and clicking on 'Geometry' in the atom context menu (YASARA Model+)
3.10.19Improved command: 'Distance', 'Angle' and 'Dihedral' can now actively change the geometry.
3.10.17Improved command: 'CheckCis' and 'CheckIso' can now be applied to individual residues, e.g. non-prolines
3.10.16New command: 'Count' the number of atoms to objects that are contained in a selection.
3.10.15Improved feature: Macros can now use the predefined variables 'Residues' and 'Objects' (in the soup).
3.10.15Improved command: CheckCis and CheckIso now return the number of cis-peptide bonds or wrong isomers.
3.10.15Improved feature: Press <CTRL>+<M> to rerun the last macro, including those chosen from the command line.
3.10.15New feature: RightClick in the VISibility column of the 'Scene Content' head-up-display to switch all other objects off.
3.10.11Improved plugin: The error report plugin adds an option to request YASARA updates from the Help menu.
3.10.11New command: 'RenameSeg' allows to change the segment ID for an atom selection.
3.10.11Improved selection syntax: the 'not' operator allows to negate entire selection blocks.
3.10.10New loop database (YASARA Structure).
3.10.10Improved support: ATI Radeon 9600 cards under Linux now fully tested.
3.10.5New highlight: Press the top right button in the sequence selector to display structural alignments.
3.10.5Important bug fix: Playing YASARA Movies from YASARA View works again. Click Help > Play movie > 'Interactive Simulations for Modeling'.
3.10.4Improved secondary structure assignment for unusual helices.
3.9.24Improved command: LoadPNG now imports the alpha channel as well.
3.9.23New command: 'UnrestImage' lets an animated image disappear immediately (YASARA Model+).
3.9.19Improved command: PlayMacro and PlayMovie can be repeated by pressing <Ctrl>+<M>
3.9.11Improved graphics: If an atom makes more than four bonds (defined via CONECT records in the PDB file), YASARA makes a better choice which four bonds to show.
3.9.10Improved command: 'Link' uses more sensitive cutoffs when searching for bonds.
3.9.8Improved PDB writer: If multiple NMR models are saved in one PDB file, the CONECT records are now collected at the end and atom numbers do not restart at 1.
3.9.8Improved PDB reader: Single amino acid ligands are graphically displayed as HetGroups and not linked if they have both C-terminal oxygens
3.9.8Improved command: 'Clean' now replaces missing backbone oxygens including both C-terminal ones
3.9.7New command: 'Move<Atom|Res|Mol>' moves atoms in the local coordinate system of an object
3.9.7New command: 'SwapImage' changes the priority of bitmaps when displayed on screen
3.9.3New plugin: Interface to the PDBFinder2 database. Click Analyze->PDBFinder2 to color your protein according to HSSP sequence conservation, entropy and PDBReport quality indicators.