Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

YASARA Development News

NOTE that this page is only updated sporadically. Better click here to access the detailed list of new features, which are released on a weekly basis.


December 2011
YASARA's built-in BLAST supports two new databases: UniRef90 and PDBC, the PDB protein sequences extracted from the coordinate section, which is more useful than the usual SEQRES data. Redundant sequences are sorted by structure quality.
October 2011
YASARA macros, plugins and scripts can freely define user interfaces to create their own custom windows whenever needed. Now every user can easily add custom functionality to YASARA.
May 2011
YASARA can create user interfaces in secondary windows, for example on a touch screen. This makes it easy for the unexperienced audience at expositions etc. to get in touch with molecular modeling, as shown in this YouTube movie .
April 2011
The DCCM (dynamic cross-correlation matrix) can be calculated from MD simulations and visualized.
March 2011
A new structural alignment algorithm matches ligands by indentifying common structural motifs .
Feburary 2011
YASARA features GPU accelerated high-quality anaglyph stereo mode that tricks the human brain into seeing full color and enables stereo everywhere, also on notebooks. Every order is now shipped with red/cyan glasses.
January 2011
The homology modeling experiment creates better alignments using sequence profiles, that can optionally be augmented with structure- based profiles of related template structures.
December 2010
YASARA supports spherical sky projections that are mirrored in protein secondary structure etc.
November 2010
YASARA includes a new selection mechanism, that permits to interactively select atoms within a rectangular box, an arbitrary area or a 3D sphere.
October 2010
A secondary structure morpher has been developed, which allows to seamlessly interpolate between realistic (close to Calphas) and idealistic (perfectly straight strands and helices) secondary structure.
September 2010
YASARA Biosciences purchased a license of David Jones' PsiPred program, which now provides more accurate secondary structure prediction, for example during homology modeling.
August 2010
YASARA's graphics engine makes full use of the ever increasing GPU power by providing phong shading (OpenGL 2.X) and hardware tessellation  (OpenGL 3.X), where the GPU increases the geometric details of the polygon meshes. Contributed by Jacobus van Meel.
July 2010
Docking with receptor flexibility is supported by creating an ensemble of receptor structures with alternative high-scoring solutions of the side-chain rotamer network.
June 2010
The secondary structure display has been improved heavily, lots of new options permit to configure every aspect (e.g. rectangular, elliptical or barbell-like helix-ribbon cross-sections).
May 2010
A stochastic rotamer optimizer generates alternative high scoring side-chain packings to capture conformational freedom .
April 2010
Dynamically updated or static & plastic wire frames can be displayed for all kinds of polygon meshes like surfaces .
March 2010
Full-scene antialiasing is available to avoid jagged polygon edges, contributed by Jacobus van Meel.
February 2010
YASARA includes an interface to the FoldX program for free energy calculations , contributed by Joost van Durme.
December 2009
YASARA provides identification, analysis and visualization of internal cavities.
October 2009
YASARA can constrain bond lengths using the LINCS algorithm to enable larger timesteps. Combined with the new MD algorithms simulations now run between 4.1 times (1 CPU core) and 5.2 times (8 CPU cores) as fast as previously.
September 2009
YASARA's molecular dynamics algorithms have been rewritten and are now the fastest around . For a typical protein simulation in explicit solvent, they run between 3.2 times (1 CPU core) and 4.3 times (8 CPU cores) as fast as previously, and require significantly less memory.
August 2009
YASARA runs simulations of membrane proteins fully automatically, at the touch of a button. This includes identification of the transmembrane region, embedding and equilibration.
June 2009
YASARA supports interlaced stereo for a new generation of screens like the Zalman ZM-M220W, allowing to build a molecular modeling cave for just 250 EUR.
March 2009
YASARA includes a customized version of APBS to solve the Poisson-Boltzmann equation , adding an additional method to calculate electrostatic potentials and solvation energies.
February 2009
Several new graphics styles to visualize electrostatic potentials are available.
January 2009
YASARA supports multiple interactive cut-planes to look inside surfaces and other objects.
December 2008
YASARA's new force fields deliver the most accurate MD simulations and win five CASP8 targets .
November 2008
YASARA's built-in Yanaconda macro language runs up to 150 times faster and features vector processing.
October 2008
An interactive oligosaccharide builder with stepwise energy-minimization has been released.
August 2008
After five years of development, the final YASARA stage 'YASARA Structure' has just been released with YASARA version 8.8.8. You are welcome to join the festive activities by clicking Help > Play help movie > Triple 8 celebration day.
August 2008
Two new force fields are available: The YASARA force field, which has been derived from YAMBER3 by adding knowledge-based dihedral potentials (one-, two- and three-dimensional), and the YASARA2 force field, which contains additional knowledge based 1D and 3D packing potentials.
August 2008
YASARA performs a new kind of force field based structure validation that works also for ligands , supporting 11 different checks.
August 2008
The NMR module to perform NMR structure determination has been released .
August 2008
A built-in (PSI-)BLAST is available, local sequence databases (PDB,SwissProt,TrEMBL) are updated automatically and augmented with additional validation data to identify the best PDB structure for a given sequence .
August 2008
YASARA optimizes Side-Chains With a Rotamer Library and very fast dead-end elimination using the SCWRL3 algorithm. Additional tuning considers electrostatic and packing interaction, as well as solvation effects.
July 2008
The 'Docking experiment' performs small molecule docking using a tuned version of AutoDock.
June 2008
YASARA contains a new pH dependent hydrogen bonding network optimizer that fully considers ligands.
May 2008
The 'HomologyModeling experiment' takes all the steps from a target FASTA sequence to a fully refined homology model and writes a scientific report about the modeling
April 2008
YASARA contains a knowledge-based loop modeler and optimizer .
March 2008
YASARA performs secondary structure prediction.
February 2008
YASARA supports side-by-side stereo for flat-screens that do not work with shutter glasses.
January 2008
A scene content browser with context menus in the top right head-up display allows to easily and quickly navigate and modify the scene.
November 2007
YASARA has a new Python interface: stand-alone Python scripts can simply import the new YASARA Python module and directly use all YASARA functions.
October 2007
YASARA supports multiple structural alignments using Arun Konagurthu's MUSTANG program, which has been fully incorporated.
September 2007
YASARA performs local Smith&Waterman and global Needleman&Wunsch sequence alignments and can use them to superpose structures.
July 2007
Douglas Theobald contributes the THESEUS maximum likelihood algorithm to superpose bundles of NMR structures fully automatically, putting more emphasis on the structurally conserved regions.
May 2007
YASARA features a new multi-threaded high-speed algorithm to draw molecular surfaces. Just like Van der Waals and solvent accessible surfaces, they now adapt in real-time to moving atoms.
March 2007
YASARA is now available for Mac OS X , including special support for Mighty Mouse and MacBook track pad.
February 2007
YASARA's OpenGL graphics engine supports real-time shadows and ambient lighting, even on old notebooks that do not have pixel/vertex shaders (OpenGL 1.2).
January 2007
YASARA gets a newly styled look that also adapts to your current operating system .
December 2006
YASARA now supports parallel molecular dynamics simulations on multiple CPUs .
September 2006
The new YAMBER3 force field is available, providing more accurate molecular dynamics simulations.
June 2006
YASARA can calculate force field energies individually per unit (atom, residue, molecule, object) to locate regions of interest.
March 2006
YASARA uses eigenvector analysis to calculate angles and dihedrals between groups of atoms like helices or planar side-chains.
January 2006
The AutoSMILES algorithm provides fully automatic force field parameter assignment for organic molecules, e.g. unusual amino acids or ligands. 98% of the PDB can now be simulated at the touch of a button.
November 2005
A new algorithm combining graph theory with chemical knowledge on valence ambiguities and preferred tautomers improves typing of hetero-polycycles, and makes it straightforward to handle complex ligands in PDB files. 
October 2005
Structure based alignments are now available in Windows and Linux using the methods CE, Multiprot and Sheba thanks to a web-server plugin developed by Emmanuel Bettler and Mikael Roche at IBCP Lyon/France.
September 2005
Molecular graphics can be augmented with all kinds of solid objects: spheres, ellipsoids, cubes, boxes, cylinders, cones, prisms and pyramids.
August 2005
YASARA now includes a SMILES based library of chemical knowledge about pH dependent bond orders and protonation patterns, making it possible to type bonds and add missing hydrogens to any organic molecule at any pH from 0 to 14.
July 2005
YASARA imports OpenOffice Impress and Microsoft PowerPoint presentations and makes it easy to add molecular animations.
May 2005
YASARA calculates Van der Waals, molecular and solvent accessible volumes
April 2005
The YASARA/WHATIF Twinset adds structural alignments, a hydrogen bonding network optimizer, a regularizer for covalent geometry and the option to analyze backbone dependent rotamer distributions.
February 2005
The YASARA/WHATIF Twinset is released. YASARA can now perform 20+ different WHAT_CHECKs: bonds, angles, torsions, omega angle, Ramachandran plot, side-chain rotamers, proline rings, chirality, planarity, backbone conformation, peptide-plane flips, bumps, 3D packing quality, inside-outside distribution, unsatisfied H-bonds, or flipped Asn/Gln/His side-chains.
January 2005
YASARA encodes MPEG movies from normal or ray-traced screenshots. Can be pasted into Powerpoint etc.
December 2004
A fast implicit solvent model using a first order boundary element approach allows to calculate solvation energies.
November 2004
A flexible implementation of multi-dimensional tables including visualization makes all kinds of data analysis very easy.
October 2004
Heavily improved surface analysis becomes available. The 'FirstSurf' command allows to subdivide surfaces, the new operators 'with distance from surface' and 'with contribution to surface' enable surface-based selections.
September 2004 A summary of the science behind YASARA is available in movie format. (PhD thesis defence, 27th of September, Radboud University).
August 2004
Structural alignments are handled by SHEBA via a Python plugin (Linux). New facilities for building small molecules have been added.
July 2004
A 'neutralizing plasma' allows to run Particle Mesh Ewald simulations also with non-neutral simulation cells. Simulation algorithms and energy calculations have been improved and run a bit faster now.
June 2004
The Spaceball 3D controller is now supported in Linux.
May 2004
YASARA shows all kinds of surfaces, with transparency and updated in real-time. Now you can see the surface adapt while you change torsion angles or run molecular dynamics simulations. Surface environments permit to display and calculate partial surfaces. An interface to the MSMS program allows to display analytic molecular surfaces.
April 2004
YASARA calculates VdW, molecular and solvent accessible surface areas.
March 2004
A plugin for Bert de Groot's CONCOORD program allows to quickly analyze protein flexibility.
February 2004
YASARA's macro language 'Yanaconda' gets an extreme makeover, with lots of new functions, better list handling and huge speedups.
November 2003
Adding chemical modifications to small molecules is much easier now.
October 2003
YASARA displays structural alignments and allows to change distances, angles and dihedrals interactively.
September 2003 YASARA is officially launched at the ICMSB 2003. Download your personal edition now!
August 2003 The YASARA PDBFINDER II plugin allows you to quickly locate conserved residues and identify the well determined regions in every PDB structure.
July 2003 WHAT IF and YASARA work together in the Twinset
June 2003 YASARA mail orders are now handled by a robotic system.
May 2003 YASARA online shop, automatic order processing.
April 2003 YASARA documentation system. Every change in the program is now reflected automatically in the documentation.
March 2003 You can now write YASARA plugins in Python to add your own functions.
February 2003 Our mascott Yami is born (2003/02/02). First YASARA tutorial written in Yanaconda: Working with Yasara.
January 2003 YASARA displays hydrogen bonds. Internal YASARA beta testing starts at the CMBI.
December 2002 YASARA gets a fully functional macro language - Yanaconda (Yet ANother Abridged COding'N'Development Approach).
November 2002 Added support for labels and arrows.
October 2002 YASARA can display molecules as balls'n'sticks and now also in true OpenGL quad-buffered stereo.
September 2002 YASARA, WHAT IF and SeqCF-Threader submit predictions for over 40 CASP5 targets. The model for target 168 is ranked first among ~150 submissions.
August 2002 Thanks to Models@Home , the new YAMBER force fields are ready, just in time for CASP5.
July 2002 A Python-based expert system for protein structure prediction, to become part of the WHAT IF/YASARA Twinset .
June 2002 A knowledge-based loop modeler, and a new scoring function for CASP5.
May 2002 YASARA gets an OpenGL based window manager and access to many different file formats thanks to OpenBabel.
April 2002 A new module to predict pKa values, also in protein crystals.
March 2002 YASARA can display three dimensional fonts with depth.
Unlimited undo/redo now available.
February 2002 YASARA can display molecules as sticks.
January 2002 YASARA's PVL based Particle Mesh Ewald module finally completed.
December 2001 Development of an object-oriented modeling environment in Python. Will become a plugin for the WHAT IF/YASARA Twinset.
November 2001 Development of a Particle Mesh Ewald (PME) module to calculate long-range electrostatic interactions starts.
October 2001 PVL based molecular dynamics algorithms enable periodic boundaries, triclinic simulation cells and faster neighbour searches.
September 2001 New very Fast Fourier Transform (FFT) algorithms using PVL.
August 2001 Multimedia presentation capabilities using OpenGL texture mapping.
July 2001 New algorithm to display molecules in space-filling mode with OpenGL and PVL, 35x faster than the usual approach.
June 2001 First molecule displayed on screen using OpenGL.
May 2001 YASARA for Linux and Windows gets basic OpenGL support.
April 2001 PVL, the Portable Vector Language, is ready and provides a huge performance boost for YASARA.
March 2001 Using Models@Home , YASARA performs large scale docking of glycosaminoglycans and proteins. See Proteins (2003) in press. 
February 2001 Using Models@Home, NOVA becomes the first 'self-parameterizing' force field. See Proteins (2002) 47,393-402.
January 2001 A new, faster implementation of the AMBER force field.
First version of YASARA for Windows, console without graphics only.
December 2000 Models@Home, a screen saver to turn idle PCs into a distributed computing cluster is ready and runs YASARA in parallel. See Bioinformatics (2002) 18 , 315-318
November 2000 www.YASARA.com goes online. The last version of YASARA for DOS is ready.
August 2000 A "Transgenic Algorithm " combined with a WHAT IF/ WHAT_CHECK/ GenThreader/ 3DPSSM/ Bioinbgu interface is applied to 8 CASP4 targets (5x homology modeling, 1x fold recognition, 2x ab initio, 5 have been submitted).
July 2000 The currently 26 PCs at the CMBI now form a distributed computing cluster, YASARA gets a parallel job scheduler.
June 2000 YASARA for Linux finally runs in console-mode, graphics are on their way.
March 2000 YASARA development moves to the Center for Molecular and Biomolecular Informatics (CMBI) in Nijmegen/Netherlands.
December 1999 A new graphical user interface allows intuitive access to all functions.
December 1998 Other force fields like AMBER can be imported.
October 1998 YASARA becomes parallel using the Molecular Dynamics Network Protocol MODYNP.
September 1998 Photorealistic molecule images can be created thanks to a POVRay interface.
June 1998 "Potentials of mean force" have been added to allow true fold prediction.
April 1998 The "Virtual Ribosome" to fold proteins based on NMR NOE restraints is ready.
January 1998 Protein/DNA docking module.
November 1997 YASARA NOVA Force Field with off-center point charges ready, first interactive real-time simulation on screen of a Pentium 133 (32 MB ram): 1ACP, 768 atoms, space filling, quad-buffered stereo, 12 frames per second.
August 1997 The molecule rendering engine triples its speed thanks to the 1st generation YAMAC (YASARA Molecule Accelerator, a directly programmed Tseng ET6000 graphics board).
May 1997 YASARA reads PDB files.
October 1996 Support for a Virtual Reality Headset including motion-tracking.
September 1996 Development of the space-fill molecule rendering engine starts.
July 1996 YASARA gets support for 3D shutter glasses.
Autumn 1993 After some early "molecular graphics" attempts on a 1MIPS machine, the first line of YASARA source code is written on an Intel 386SX/20MHz, 2MB ram, MS-DOS.