Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

° 

Database interfaces

° 

Plugins

Plugins are Python scripts or Yanaconda macros that extend YASARA's user interface and get activated when you click the respective option. They are the method of choice to extend YASARA with your own functions.

All plugins are distributed together with YASARA and should be available from the graphical user interface. Windows users need to have Python from www.python.org installed.

To reinstall a plugin, just download the ZIP file and unpack it in the yasara/plg directory. If you then restart YASARA, the new options will appear in the menus. If you are not sure where the option appears, look at the top of the main plugin file (*.mcr or *.py).

° 

Interface to PDBFinderII

This plugin lets the user select residues, retrieves the PDBFinderII entry for the corresponding PDB file via HTTP and then colors the residues based on a selected property: sequence entropy/conservation, hotspots for insertions/deletions and lots of different quality indicators. The color gradient goes from blue (unimportant,perfect) over magenta and red (interesting,allright) to yellow (very important to look at,probably wrong). Grey indicates that no data are available. Click View > Color > Residue by feature

Written by: Elmar Krieger

License: GPL (www.gnu.org)

Last modified: 2010/07/08

° 

Interface to MCSIS

This plugin queries the Molecular Class Specific Information System (www.cmbi.kun.nl/mcsis) for mutations in a protein, highlights the residues and gives a summary of the mutation effects. Note that this requires the MCSIS database to be installed locally. Since MCSIS development has been paused, this is currently not possible, this plugin therefore mainly serves as an example for similar applications.

Written by: Emmanuel Bettler

License: GNU GPL

Last modified: 2010/07/08

° 

Retrieve a PDB file by FTP

This plugin asks for a PDB ID and retrieves the file from www.rcsb.org. Click File > Get by FTP.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2010/07/08