Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
What does YASARA look like? Click here to visit the OpenGL screenshot gallery .
Tyrosine Chi1/2 correlation plot
Molecular modeling of myosine
Real-time molecular dynamics simulation
Interactive surface visualization
Water molecules rolling over molecular surface

Click here for instant download!
YASARA delivers the most accurate protein simulations, winning 5 CASP8 targets, read more here.
NEW: Now featuring the fastest molecular dynamics algorithms, see benchmarks.
NEW: Simulate membrane proteins at the touch of a button.


WELCOME TO

YASARA Logo

Yet Another Scientific Artificial Reality Application



About YASARA - Watching Nature@Work
 
Structure of the day, press Reload if outdated. Click for animation

YASARA is a molecular-graphics, -modeling and -simulation program for Windows, Linux and Mac OS X developed since 1993, that finally makes it really easy to answer your questions. With an intuitive user interface, photorealistic graphics and support for affordable shutter glasses, autostereoscopic displays and input devices, YASARA creates a new level of interaction with the 'artificial reality', that allows you to focus on your goal and forget about the details of the program.

YASARA is powered by PVL (Portable Vector Language), a new development framework that provides performance way above traditional software . PVL allows you to visualize even the largest proteins and enables true interactive real-time simulations with highly accurate force fields on standard PCs (see benchmarks). You can push and pull molecules around and work with dynamic models instead of static pictures.

Being rooted in the academic world, all methods introduced by YASARA are described in peer-reviewed journals . You can obtain the initial stage 'YASARA View ' for free, while higher stages (YASARA Model, YASARA Dynamics , YASARA Structure) require a license fee that allows us to guarantee new developments, updates and support also in the future, independent of temporary grants. As a YASARA user, you are not limited to the role of a consumer. If you decide to share your developments with the community (macros, movies, Python plugins or just feedback), you receive credits that in turn give you free access to all stages of YASARA. Click here to see how others work with YASARA..


Unique YASARA features
 

In addition to a wide range of functions that can partly also be found in other programs, YASARA provides a number of features with unique properties:
Molecular graphics Molecular movies and eLearning
Molecular dynamics with 4 clicks Interactive real-time surfaces
New force fields: YASARA , YAMBER, NOVA pH dependent typing of organic molecules
Fastest molecular dynamics algorithms, see benchmarks
MD simulation of membrane proteins with 4 clicks
Automatic force field parameter assignment for 98% of the PDB
Yanaconda macros and Python scripts
Homology modeling with 4 clicks and CASP approval
Small-molecule docking with 4 clicks
Loop modeling Side-chain prediction
pH dependent hydrogen bonding networks Structure validation including ligands
NMR structure determination with 4 clicks Multi-dimensional knowledge-based potentials


WHAT IF YASARA knows the answer?!
 
The WHAT IF / YASARA Twinset

With over 1000 citations, WHAT IF is a widely used modeling program, well known e.g. for its structure validation and prediction tools. The WHAT IF / YASARA Twinset is a unified all-in-one distribution of the two programs with extended functionality. If you run the Twinset WHAT IF,   an additional YASARA menu provides quick access to molecular simulations. And vice versa, users of the Twinset YASARA can simply run WHAT IF commands, so that WHAT IF inherits YASARA's user interface, graphics engine, macro language and convenience functions like unlimited undo/redo. This approach makes WHAT IF quickly accessible, also to users outside the bioinformatics expert community. 


Acknowledgements : YASARA would not exist in its present form without the support of: Prof. Dr. Gregor Högenauer (Institute for Molecular biology, Biochemistry and Microbiology, IMBM , University of Graz, Austria), Prof. Dr. Günther Koraimann (IMBM , University of Graz, Austria), Prof. Dr. Andreas Kungl (Institute for Pharmaceutical Chemistry , University of Graz, Austria), Prof. Dr. Gert Vriend ( CMBI, University of Nijmegen, the Netherlands). YASARA is a molecular graphics, modeling and simulation program for Linux, Windows and Mac OS X, (C)1993-2009 by Elmar Krieger.