Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

° 

Macros

Macros are written using the Yanaconda language. If you already know a programming language, you can learn Yanaconda in 15 minutes, otherwise it may take 30.

To install, just save the macro in the directory yasara/mcr or wherever you want it. The syntax of Yanaconda is described in the YASARA documentation.

° 

Molecular dynamics

° 

Analyzing a molecular dynamics trajectory

This macro analyzes a simulation and creates a table with energies and RMSDs from the starting structure, as well as the minimum energy structure and the time average structure with B-factors calculated from the root mean square fluctuations. If you want to do your own analysis, search for 'examples'.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/11/02

Download: md_analyze.mcr

° 

Running a molecular dynamics simulation of a membrane protein

This macro sets up and runs a membrane simulation. It scans the protein for secondary structure elements with hydrophobic surface residues, orients it accordingly and embeds it in a membrane of adjustable lipid composition. Finally a 250 ps restrained equilibration simulation is run, which ensures that the membrane can adapt to the newly embedded protein. Then the real simulation starts.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/11/02

° 

Refining a homology model by molecular dynamics simulation in water

This macro runs a 500 ps simulation of a homology model using the protocol described in Proteins 57,678-683. It saves one PDB file every 25 picoseconds, including a table with force field energies to identify the best snapshot. In YASARA Structure, this table additionally contains Dihedrals, Packing1D and Packing3D checks (see the Check command). And in the Twinset, three more checks are included: PhiPsi, Backbone and Packing3.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/09/18

Download: md_refine.mcr

° 

Running a steered molecular dynamics simulation in water

This macro sets up and runs a steered simulation to pull a ligand from its binding site. As soon as they have been pulled apart completely and atoms start crossing periodic boundaries, the macro works no longer correctly

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/09/18

° 

Running an accurate molecular dynamics simulation in water

This macro sets up and runs a simulation. It can also continue a simulation that got interrupted.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/09/18

Download: md_run.mcr

° 

Play back a molecular dynamics trajectory

This macro plays provides an interactive molecular dynamics trajectory player

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/06/07

Download: md_play.mcr

° 

Analyzing the change of secondary structure in a molecular dynamics trajectory

This macro analyzes a simulation and creates a table with per-residue secondary structure as well as a graphical plot

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/05/22

° 

Analyzing a molecular dynamics trajectory of multiple objects

This macro analyzes a simulation and creates a table with energies and RMSDs from the starting structures for multiple objects

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/05/22

° 

Analyzing a molecular dynamics trajectory per residue

This macro analyzes a simulation and creates a table with average RMSFs and RMSDs from the starting structure per residue

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/03/23

° 

Convert between SIM and XTC simulation trajectories

This macro converts an existing MD trajectory between various formats. Supported are SIM->XTC, SIM->PDB, SIM->SIM, XTC->SIM and XTC->PDB.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2010/04/11

Download: md_convert.mcr

° 

Molecular modeling

° 

Running an energy minimization

This macro runs an energy minimization of the soup. Compared to the normal minimization experiment, it temporarily adds a water shell so that all force fields can be used directly, also those optimized for use with explicit solvent

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/09/18

Download: em_run.mcr

° 

Structure determination

° 

Solve an NMR structure with fixed quality

This macro solves an NMR structure based on a protein sequence and a restraint file in XPLOR format. Contrary to the normal nmr_solve macro, it refines only those structures in water, that match a quality criterion, and performs an unlimited number of folding runs until the ensemble has the requested size

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

° 

Solve an NMR structure

This macro solves an NMR structure based on a protein sequence and a restraint file in XPLOR format

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

Download: nmr_solve.mcr

° 

Set default parameters for NMR structure determination

This macro is included by others to set default parameters

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

° 

Refine an NMR ensemble in explicit solvent

This macro refines an NMR ensemble in explicit solvent to increase the accuracy

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

° 

Refine an NMR ensemble in vacuo

This macro refines a roughly folded structure in vacuo to create a realistic fold

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

° 

Fold an ensemble of NMR structures

This macro folds a structure from the stretched-out conformation using NMR restraints

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

Download: nmr_fold.mcr

° 

Analyze and merge an NMR ensemble

This macro analyzes an NMR ensemble and merges the members into a single PDB file

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

Download: nmr_analyze.mcr

° 

Structure prediction

° 

Docking a ligand to a receptor

This macro predicts the structure of a ligand-receptor complex. It can also continue a docking run that got interrupted. An analysis log file is written at the end.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/01/19

Download: dock_run.mcr

° 

Building a homology model

This macro builds a homology model using a FASTA sequence of the target, and optionally template structures and alignments

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2012/01/02

Download: hm_build.mcr

° 

Showing the docking results interactively

This macro provides an interactive player to cycle through the docking poses and clusters

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/06/07

Download: dock_play.mcr

° 

Docking a ligand to a receptor ensemble with flexible side-chains

This macro predicts the structure of a ligand-receptor complex. Receptor flexibility is considered by creating a receptor ensemble with alternative high-scoring solutions of the side-chain rotamer network. An analysis log file is written at the end. The macro can also continue a docking run that got interrupted, especially if the scene has not been moved or rotated manually during the docking.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/05/22

° 

Docking a ligand to a receptor locally

This macro samples local ligand conformations in a user-supplied complex. An analysis log file is written at the end.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2011/05/22

° 

Building a homology model

This macro builds a homology model using a FASTA sequence of the target, and optionally template structures and alignments. It takes some shortcuts (alignment quality, number of templates, refinement) to finish as quickly as possible

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2010/05/30