Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

° 

Molecular modeling

° 

Movies

To install a movie, just download the ZIP file and unpack it in the yasara/mov directory (which of course requires that you have at least YASARA View installed). If you then click on Help > Play help movie, the new movie will appear in the list.

Movies are simply YASARA macros, that use multimedia elements to create interactive tutorials or presentations. Works well instead of the usual PowerPoint approach. Instructions how to create your own movies can be found in the YASARA documentation by clicking on 'Recipes - Answer complex questions' -> 'Create your own YASARA movies'.

° 

Knowledge-based potentials

Figure: A snapshot from the movie
An overview of knowledge-based potentials. What they are, how to visualize them and how to use them.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/08/18

° 

Building small molecules

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL, except stellar nebula (copyright by Jaime Vives Piqueres)

Last modified: 2008/07/11

° 

Plugins

Plugins are Python scripts or Yanaconda macros that extend YASARA's user interface and get activated when you click the respective option. They are the method of choice to extend YASARA with your own functions.

All plugins are distributed together with YASARA and should be available from the graphical user interface. Windows users need to have Python from www.python.org installed.

To reinstall a plugin, just download the ZIP file and unpack it in the yasara/plg directory. If you then restart YASARA, the new options will appear in the menus. If you are not sure where the option appears, look at the top of the main plugin file (*.mcr or *.py).

° 

Align3D

This plugin performs a structural alignment with the help of various programs or web servers: Sheba by J.Jung & B.Lee, which is downloaded automatically from http://rex.nci.nih.gov/RESEARCH/basic/lmb/mms/sheba.htm in Linux, Multiprot by Shatsky, Nussinov & Wolfson and CE by Shindyalov & Bourne. YASARA Plugin developed at the IBCP France, see http://pbil.ibcp.fr/~ebettler/stages/mroche/. Click Analyze > Align.

Written by: Mikael Roche & Emmanuel Bettler

License: GNU GPL

Last modified: 2007/09/03