Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Download Center V12.1


  • The Models@Home User's Manual contains all the information you need to get your own cluster running. Requires Adobe Acrobat Reader :

ModelGuide.pdf (last update from 2012/01/07)

  • The Models@Home Distribution is a ~10 MB Zip-file for Linux and Windows, including the cluster interface source code to use in your own programs. Since V12.1, multiple CPU cores are supported.

cluster.zip (V12.1 with last update from 2012/01/07)

  • The Models@Home paper published in Bioinformatics 18, 315-318, copyright Oxford University Press.

ModelsAtHome.pdf

  • Supplementary material: The Models@Home paper in Microsoft Word format and a Models@Home Power Point presentation in case you want to use some of the text and graphics.

ModelsAtHomeSup.zip

Optional downloads in case you want to modify the source code:

id_linux.tar.gz (last update from 2001/10/30)

id_windows.zip

  • Source code for the remaining Models@Home modules (Server, Exec and ScrSaver):

Additional License Agreement for the Models@Home source code:

The Models@Home source code "cluster.c" is available on a "tit for tat" basis
with the following additional conditions:

  • You are allowed to modify/adapt the source code.

  • We help each other by swapping source code: For every change you make, please email the file back to Eliza@yasara.com with cluster.c in the email subject field.

  • If you add these changes to separate files and link them with cluster.c, you must also return these separate source code files.

Your name (first name,family name):