Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)

° 

Movies

To install a movie, just download the ZIP file and unpack it in the yasara/mov directory (which of course requires that you have at least YASARA View installed). If you then click on Help > Play help movie, the new movie will appear in the list.

Movies are simply YASARA macros, that use multimedia elements to create interactive tutorials or presentations. Works well instead of the usual PowerPoint approach. Instructions how to create your own movies can be found in the YASARA documentation by clicking on 'Recipes - Answer complex questions' -> 'Create your own YASARA movies'.

° 

General

° 

Working with YASARA

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/01/07

Download: http://yasara3.cmbi.ru.nl/welcome.zip

° 

Calibrating and using the P5 data glove

Figure: A snapshot from the movie
This tutorial allows you to calibrate the P5 data glove available from www.EssentialReality.com. Usage instructions are also included.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2007/10/19

Download: http://yasara3.cmbi.ru.nl/p5.zip

° 

Working with the Twinset
Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2007/07/31

Download: http://yasara3.cmbi.ru.nl/twinset.zip

° 

Molecular graphics

° 

Surfaces III - Electrostatics

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2007/07/31

Download: http://yasara3.cmbi.ru.nl/surfaces3.zip

° 

Surfaces II - Environments
Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2007/07/31

Download: http://yasara3.cmbi.ru.nl/surfaces2.zip

° 

Surfaces I - Introduction
Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2007/07/31

Download: http://yasara3.cmbi.ru.nl/surfaces.zip

° 

The Basics

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2007/07/31

Download: http://yasara3.cmbi.ru.nl/molgra.zip

° 

Lighting and shadows

Figure: A snapshot from the movie
An introduction to lighting and shadows in YASARA. Many thanks to Sven Geier for his marvellous 'Thetaspace' background (more at http://www.its.caltech.edu/~sgeier/)

Written by: Elmar Krieger & Sven Geier

License: GNU GPL

Last modified: 2007/07/31

Download: http://yasara3.cmbi.ru.nl/lighting.zip

° 

Molecular dynamics

° 

Interactive simulations for modeling

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2008/01/07

Download: http://yasara3.cmbi.ru.nl/mdinteract.zip

° 

The YAMBER force field, ICMSB 2003

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2007/10/19

Download: http://yasara3.cmbi.ru.nl/yamber.zip

° 

The theory behind molecular dynamics simulations

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2007/10/19

Download: http://yasara3.cmbi.ru.nl/mdintro.zip

° 

Simulation and quantum mechanics of small molecules

Figure: A snapshot from the movie
This tutorial introduces fractional bond orders and pH dependency, shows how to build and simulate small molecules, and how to use quantum mechanics to optimize geometries and compare tautomers.

Written by: Elmar Krieger

License: GNU GPL, except coral reef background by Ove Hoegh-Guldberg (Centre for Marine Studies, University of Queensland)

Last modified: 2007/07/31

Download: http://yasara3.cmbi.ru.nl/smallmol2.zip

° 

Accurate simulations in water

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2007/07/31

Download: http://yasara3.cmbi.ru.nl/mdwater.zip

° 

Molecular modeling

° 

Building small molecules

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL, except stellar nebula (copyright by Jaime Vives Piqueres)

Last modified: 2007/07/31

Download: http://yasara3.cmbi.ru.nl/smallmol.zip

° 

Research topics

° 

PhD Thesis Defence 2004/09/27 by Elmar Krieger

Figure: A snapshot from the movie
Written by: Elmar Krieger

License: GNU GPL

Last modified: 2007/10/19

Download: http://yasara3.cmbi.ru.nl/thesis.zip

° 

PhD Thesis Defence 2006/02/09 by Sander Nabuurs

Figure: A snapshot from the movie
Written by: Sander Nabuurs

License: GNU GPL

Last modified: 2007/07/31

Download: http://yasara3.cmbi.ru.nl/thesis2.zip

° 

Methionine Synthase

Figure: A snapshot from the movie
An overview of the catalytic activity of methionine synthase

Written by: Richard Deth & Elmar Krieger

License: GNU GPL

Last modified: 2007/07/31

Download: http://yasara3.cmbi.ru.nl/metsynthase.zip

° 

Multimedia

° 

The protein structure group at the CMBI

Figure: A snapshot from the movie
An introduction to the 'Vriend Group' at the CMBI, can be easily adapted to introduce your own research group

Written by: Elmar Krieger

License: GNU GPL, Grass texture by Rune S. Johansen

Last modified: 2007/10/19

Download: http://yasara3.cmbi.ru.nl/cmbi.zip

° 

The crazy pig animation
Figure: A snapshot from the movie
This is an example for multimedia animations, in honour of the Pink Pig (www.pinkpigpage.com).

Written by: Emmanuel 'CrazyPig' Bettler

License: Images copyright by pinkpigpage.com

Last modified: 2007/10/19

Download: http://yasara3.cmbi.ru.nl/crazypig.zip

° 

Buckynut Island

Figure: A snapshot from the movie
A video game written in Yanaconda to demonstrate the use of solids. Help Yami collect the Buckminster nuts. (Current highscore is 215 points by Bas Vroling)

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2007/07/31

Download: http://yasara3.cmbi.ru.nl/buckynut.zip