Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Scientific News

YASARA is used every day to tackle scientific questions, usually in collaboration with experimental research groups. If you also have a riddle to solve, just contact us, we are always looking for opportunities to apply our software to problems of practical interest. A larger list of YASARA related articles published by its users is available here.



January 2010
In another join-project with the Department of Metabolic and Endocrine Diseases, University Medical Center Utrecht, YASARA is used to analyze mutations in ATP8B1, a putative aminophospholipid-translocating P-type adenosine triphosphatase, which are linked to hereditary cholestasis:
Folding defects in P-type ATP 8B1 associated with hereditary cholestasis are ameliorated by 4-phenylbutyrate
van der Velden LM, Stapelbroek JM, Krieger E, van den Berghe PV, Berger R, Verhulst PM, Holthuis JC, Houwen RH, Klomp LW, van de Graaf SF
Hepatology. 2010 Jan;51(1):286-96
December 2009
Proteins CASP8 Special IssueThe YASARA force field with knowledge-based dihedral potentials , that has been optimized to yield stable energy minima close to native X-ray structures is described in the CASP8 special issue of Proteins, more details about YASARA's CASP8 performance can be found here . YASARA's homology modeling module is also outlined briefly. The journal cover shows how the various dihedrals in an arginine residue are combined by YASARA's multi-dimensional potentials:
Improving physical realism, stereochemistry, and side-chain accuracy in homology modeling: Four approaches that performed well in CASP8
Krieger E, Joo K, Lee J, Lee J, Raman S, Thompson J, Tyka M, Baker D, Karplus K
Proteins. 2009;77 Suppl 9:114-22
November 2009
Together with Peter van den Berghe and Leo Klomp at the Department of Metabolic and Endocrine Diseases, University Medical Center Utrecht, YASARA is used to investigate mutations in the ATP7B transmembrane ATPase causing Wilson disease, an autosomal recessive copper overload disorder:
Reduced expression of ATP7B affected by Wilson disease-causing mutations is rescued by pharmacological folding chaperones 4-phenylbutyrate and curcumin
van den Berghe PV, Stapelbroek JM, Krieger E, de Bie P, van de Graaf SF, de Groot RE, van Beurden E, Spijker E, Houwen RH, Berger R, Klomp LW
Hepatology. 2009 Dec;50(6):1783-95
August 2009
A new introduction to homology modeling has been published, partly based on the one from March 2003:
Homology modelling and spectroscopy, a never-ending love story
Venselaar H, Joosten RP, Vroling B, Baakman CA, Hekkelman ML, Krieger E, Vriend G
Eur Biophys J. 2009 Aug 29
July 2008
In a collaboration with Jan Koenderink at the Department of Pharmacology and Toxicology, Radboud University Nijmegen Medical Centre, Netherlands, YASARA is used to build a model of Multidrug Resistance Protein 4 (MRP4) and analyze the effects of point mutations on substrace specificity:
Functional Role of Arginine 375 in Transmembrane Helix 6 of Multidrug Resistance Protein 4 (MRP4/ABCC4)
El-Sheikh AA, van den Heuvel JJ, Krieger E, Russel FG, Koenderink JB
Mol Pharmacol. 2008 Oct;74(4):964-71
October 2007
In another joint-project with Ersan Kalay and Hannie Kremer at the Department of Human Genetics , Radboud University Nijmegen Medical Centre, YASARA is used to analyze a point-mutation in myosin XVA, linked to hearing loss:
MYO15A (DFNB3) mutations in Turkish hearing loss families and functional modeling of a novel motor domain mutation
Kalay E, Uzumcu A, Krieger E, Caylan R, Uyguner O, Ulubil-Emiroglu M, Erdol H, Kayserili H, Hafiz G, Baserer N, Heister AJ, Hennies HC, Nurnberg P, Basaran S, Brunner HG, Cremers CW, Karaguzel A, Wollnik B, Kremer H
Am J Med Genet A. 2007 Oct 15;143(20):2382-9
August 2007
In a continued collaboration project with Ilse Gosens and Ronald Roepman at the Department of Human Genetics, Radboud University Nijmegen Medical Centre, YASARA analyzes the dimerization potential of additional MPP family members involved in retinal patterning defects:
MPP1 links the Usher protein network and the Crumbs protein complex in the retina
Gosens I, van Wijk E, Kersten FF, Krieger E, van der Zwaag B, Marker T, Letteboer SJ, Dusseljee S, Peters T, Spierenburg HA, Punte IM, Wolfrum U, Cremers FP, Kremer H, Roepman R
Hum Mol Genet. 2007 Jun 21
September 2006
In collaboration with Ester Damen and Jeroen van Leeuwen at the Department of Cell Biology, Radboud University Nijmegen, YASARA analyzes the phosphatase activity of Vps29, a member of the retromer complex, in the context of several point mutations:
The human Vps29 retromer component is a metallo-phosphoesterase for a cation-independent mannose 6-phosphate receptor substrate peptide
Damen E, Krieger E, Nielsen JE, Eygensteyn J, van Leeuwen JE
Biochem J. 2006 Sep 15;398(3):399-409
May 2006
Structure coverYASARA's new NMR structure determination module is used in collaboration with Elena and Stefan Harjes at the Max-Planck Institute of Molecular Physiology in Dortmund to solve the structure of the Nore1 C1 domain, a novel Ras effector capable of inducing apoptosis. The cover illustration has also been created with YASARA.
GTP-Ras Disrupts the Intramolecular Complex of C1 and RA Domains of Nore1.
Harjes E, Harjes S, Wohlgemuth S, Muller KH , Krieger E, Herrmann C, Bayer P.
Structure. 2006 May;14(5):881-8.
April 2006
YASARA's empirical approach to pKa prediction in periodic boundaries is described, helping for example to reconstruct high resolution protein crystals for molecular dynamics force field development:
Fast empirical pK(a) prediction by Ewald summation.
Krieger E, Nielsen JE, Spronk CA, Vriend G.
J Mol Graph Model. 2006 Apr 25
December 2005
In collaboration with Ronald Roepman at the Department of Human Genetics, Radboud University Nijmegen , YASARA & WHAT IF model the RPGR-interacting protein 1 and find a potential Calcium binding site, whose disruption is likely to cause autosomal recessive congenital blindness (LCA):
Interaction of nephrocystin-4 and RPGRIP1 is disrupted by nephronophthisis or Leber congenital amaurosis-associated mutations.
Roepman R, Letteboer SJ, Arts HH, van Beersum SE , Lu X, Krieger E, Ferreira PA, Cremers FP.
Proc Natl Acad Sci U S A. 2005 Dec 20;102(51):18520-5
October 2005
Sander Nabuurs at the CMBI uses YASARA's PDBFinder2 (click Analyze > PDBFinder2 properties) to investigate the relationship between the amount of available NMR data and structure quality.
Definition of a new information-based per-residue quality parameter.
Nabuurs SB, Krieger E, Spronk CA, Nederveen AJ , Vriend G, Vuister GW.
J Biomol NMR. 2005 Oct;33(2):123-34.
September 2005
JBC coverLi Yan Qiu and the ATPase team at the Department of Biochemistry , NCMLS, Radboud University Nijmegen, manage to transfer the ability to bind the cardiac glycoside Ouabain between two ATPases by mutating just seven amino acids. The structural basis is analyzed with YASARA, combined with a Flexx docking study by Gijs Schafenaar. YASARA contributes the cover to the new JBC outfit .
Reconstruction of the Complete Ouabain-binding Pocket of Na,K-ATPase in Gastric H,K-ATPase by Substitution of Only Seven Amino Acids.
Qiu LY, Krieger E, Schaftenaar G, Swarts HG , Willems PH, De Pont JJ, Koenderink JB.
J Biol Chem. 2005 Sep 16;280(37):32349-55
June 2005
In a joint-project with Albena Kantardzhieva and Ronald Roepman, YASARA analyzes the dimerization potential of various MPP family members in an attempt to shed some light on the molecular mechanisms of inherited retinopathies.
MPP5 recruits MPP4 to the CRB1 complex in photoreceptors.
Kantardzhieva A, Gosens I, Alexeeva S, Punte IM , Versteeg I, Krieger E, Neefjes-Mol CA, den Hollander AI , Letteboer SJ, Klooster J, Cremers FP, Roepman R, Wijnholds J .
Invest Ophthalmol Vis Sci. 2005 Jun;46(6):2192-201
March 2005
Together with Herman Swarts, Jan Koenderink and Jan Joep de Pont at the Department of Biochemistry , NCMLS, Radboud University Nijmegen, YASARA helps to continue the analysis of the K+ binding site in gastric H,K-ATPase,
Asn792 Participates in the Hydrogen Bond Network Around the K+-binding Pocket of Gastric H,K-ATPase.
Swarts HG, Koenderink JB, Willems PH, Krieger E, De Pont JJ.
J Biol Chem. 2005 Mar 25;280(12):11488-94
December 2004
Chris Spronk at the CMBI uses YASARA for molecular graphics and cis-peptide bond statistics in the review
Validation of protein structures derived by NMR spectroscopy.
Spronk CA, Nabuurs SB, Krieger E, Vriend G, Vuister GW.
Progress in NMR spectroscopy. 2004 45:315-337.
November 2004
YASARA's second-generation self-parameterizing force fields for high-resolution refinement YAMBER and YAMBER II are described:
Making optimal use of empirical energy functions: Force-field parameterization in crystal space.
Krieger E, Darden T, Nabuurs SB, Finkelstein A, Vriend G.
Proteins. 2004 57(4):678-683
July 2004
In a second joint-project with Mirjam Luijendijk, Erwin van Wijk and Hannie Kremer at the Department of Otorhinolaryngology , UMC Nijmegen, YASARA & WHAT IF model myosin VIIA and find that a mutation linked to hearing impairment is located in direct vicinity of the flexible hinge that undergoes conformational changes during the myosin power stroke.
Identification and molecular modelling of a mutation in the motor head domain of myosin VIIA in a family with autosomal dominant hearing impairment (DFNA11).
Luijendijk MW, Van Wijk E, Bischoff AM, Krieger E, Huygen PL, Pennings RJ, Brunner HG, Cremers CW, Cremers FP, Kremer H.
Hum Genet. 2004 115(2):149-56.
April 2004
Together with Jan Koenderink and Jan Joep de Pont at the Department of Biochemistry , NCMLS, Radboud University Nijmegen, YASARA & WHAT IF are used to model the gastric H,K-ATPase, YASARA's ion-site prediction module helps to locate potassium binding residues, and a series of mutations involving a crucial salt-bridge are analyzed:
A conformation-specific interhelical salt bridge in the K+ binding site of gastric H,K-ATPase.
Koenderink JB, Swarts HG, Willems PH, Krieger E, De Pont JJ.
J Biol Chem. 2004 16;279(16):16417-24.
March 2004
YASARA's forthcoming docking module is used to analyze the interaction between Interleukin-8 and Heparin, in collaboration with Andreas Kungl at the Institute of Pharmaceutical Chemistry & Technology at the University of Graz, Austria:
A structural and dynamic model for the interaction of interleukin-8 and glycosaminoglycans: support from isothermal fluorescence titrations.
Krieger E, Geretti E, Brandner B, Goger B, Wells TN, Kungl AJ.
Proteins. 2004 54(4):768-75.
December 2003
In a joint-project with Erwin van Wijk and Hannie Kremer at the Department of Otorhinolaryngology , UMC Nijmegen, YASARA & WHAT IF  are used to analyze a mutation in the core of ACTG1, its presumed effect on the protein structure and its relationship to correlated mutations in other species.
A mutation in the gamma actin 1 (ACTG1) gene causes autosomal dominant hearing loss (DFNA20/26).
van Wijk E, Krieger E, Kemperman MH, De Leenheer EM, Huygen PL, Cremers CW, Cremers FP, Kremer H.
J Med Genet. 2003 40(12):879-84.
November 2003
In collaboration with the Groningen Biomolecular Sciences and Biotechnology Institute , YASARA & WHAT IF build a model of the PTS1-receptor and the bound PTS1-peptide:
Fluorescence analysis of the Hansenula polymorpha peroxisomal targeting signal-1 receptor, Pex5p.
Boteva R, Koek A, Visser NV, Visser AJ, Krieger E, Zlateva T, Veenhuis M, van der Klei I.
Eur J Biochem. 2003 270(21):4332-8.
October 2003 In collaboration with the Erasmus Medical Center Rotterdam , YASARA & WHAT IF build a model of the DJ-1 protein to predict the effect of mutations, more details published in:
DJ-1( PARK7), a novel gene for autosomal recessive, early onset parkinsonism.
Bonifati V, Rizzu P, Squitieri F, Krieger E, Vanacore N, van Swieten JC, Brice A, van Duijn CM, Oostra B, Meco G, Heutink P.
Neurol Sci. 2003 24(3):159-60.
October 2003
Sander Nabuurs makes extensive use of YASARA while determining the information content of NMR restraints:
Quantitative Evaluation of Experimental NMR Restraints.
Nabuurs SB, Spronk CA, Krieger E, Maassen H, Vriend G, Vuister GW.
J Am Chem Soc. 2003 125(39):12026-12034.
March 2003 Chris Spronk at the CMBI gets assistance from YASARA & WHAT IF to analyze the precision of NMR structure ensembles:
The precision of NMR structure ensembles revisited.
Spronk CA, Nabuurs SB, Bonvin AM, Krieger E, Vuister GW, Vriend G.
J Biomol NMR. 2003 25(3):225-34.
February 2003 YASARA contributes scientific results and molecular graphics in the review:
Homology modeling.
Krieger E, Nabuurs SB, Vriend G.
Methods Biochem Anal. 2003;44:509-23.
January 2003 In collaboration with the Erasmus Medical Center Rotterdam , YASARA & WHAT IF build a model of the DJ-1 protein to predict the effect of mutations:
Mutations in the DJ-1 gene associated with autosomal recessive early-onset parkinsonism.
Bonifati V, Rizzu P, van Baren MJ, Schaap O, Breedveld GJ, Krieger E, Dekker MC, Squitieri F, Ibanez P, Joosse M, van Dongen JW, Vanacore N, van Swieten JC, Brice A, Meco G, van Duijn CM, Oostra BA, Heutink P.
Science. 2003 299(5604):256-9
January 2003 In another collaboration with the Erasmus Medical Center Rotterdam, YASARA & WHAT IF model fibroblast growth factor 14 and help to analyze a mutation:
A mutation in the fibroblast growth factor 14 gene is associated with autosomal dominant cerebellar ataxia.
van Swieten JC, Brusse E, de Graaf BM, Krieger E, van de Graaf R, de Koning I, Maat-Kievit A, Leegwater P, Dooijes D, Oostra BA, Heutink P.
Am J Hum Genet. 2003 72(4):1078.
May 2002 The new YASARA NOVA force field is described:
Increasing the precision of comparative models with YASARA NOVA--a self-parameterizing force field.
Krieger E, Koraimann G, Vriend G.
Proteins. 2002 47(3):393-402.
April 2002 In collaboration with the Department of Human Genetics, UMC Nijmegen , YASARA & WHAT IF model the p63 protein and investigate a gain-of function mutation:
Gain-of-function mutation in ADULT syndrome reveals the presence of a second transactivation domain in p63.
Duijf PH, Vanmolkot KR, Propping P, Friedl W, Krieger E, McKeon F, Dotsch V, Brunner HG, van Bokhoven H.
Hum Mol Genet. 2002 11(7):799-804.
March 2002 In collaboration with the Department of Molecular Cell Biology at the VUMC Amsterdam , YASARA & WHAT IF model the HIV-1 receptor DC-SIGN and help to investigate various mutants:
Identification of different binding sites in the dendritic cell-specific receptor DC-SIGN for intercellular adhesion molecule 3 and HIV-1.
Geijtenbeek TB, van Duijnhoven GC, van Vliet SJ, Krieger E, Vriend G, Figdor CG, van Kooyk Y.
J Biol Chem. 2002 277(13):11314-20.
February 2002 The Models@Home distributed computing system, which allows YASARA to tackle questions with very high computational requirements, is described:
Models@Home: distributed computing in bioinformatics using a screensaver based approach.
Krieger E, Vriend G.
Bioinformatics. 2002 18(2):315-8.