Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)

° 

YASARA Screenshots

Below you find a large number of YASARA screenshots. All images are exact copies of the YASARA window, taken on an nVIDIA Geforce and Linux. The Windows and MacOSX versions look identical, except for the user interface.

Figure: An example for the AddEnv command.

Figure: An example for the AddHyd command.

Figure: An example for the AddRes command.

Figure: An example for the AddRes command.

Figure: An example for the AlignPDBMol command.

Figure: An example for the AlignAtom command.

Figure: An example for the Align command.

Figure: An example for the AtomTexture command.

Figure: An example for the AtomTexture command.

Figure: An example for the BallStickRadius command.

Figure: An example for the BallStick command.

Figure: An example for the Ball command.

Figure: An example for the BLAST command.

Figure: An example for the BuildAtom command.

Figure: An example for the BuildLoop command.

Figure: An example for the BuildMol command.

Figure: An example for the BuildRes command.

Figure: An example for the Cell command.

Figure: An example for the Cell command.

Figure: An example for the Cell command.

Figure: An example for the Check command.

Figure: An example for the Check command.

Figure: An example for the ColorBonds command.

Figure: An example for the ColorBG command.

Figure: An example for the Color command.

Figure: An example for the Color command.

Figure: An example for the Crystallize command.

Figure: An example for the Cut command.

Figure: An example for the DCCM command.

Figure: An example for the Dihedral command.

Figure: An example for the Distance command.

Figure: An example for the Experiment command.

Figure: An example for the Experiment command.

Figure: An example for the Experiment command.

Figure: An example for the Experiment command.

Figure: An example for the Experiment command.

Figure: An example for the Experiment command.

Figure: An example for the FillCellObj command.

Figure: An example for the FillCellObj command.

Figure: An example for the FillCellWater command.

Figure: An example for the FirstSurf command.

Figure: An example for the Fix command.

Figure: An example for the Fog command.

Figure: An example for the Font command.

Figure: An example for the ForceField command.

Figure: An example for the FormEnergy command.

Figure: An example for the Hide command.

Figure: An example for the JoinObj command.

Figure: An example for the LabelDis command.

Figure: An example for the Label command.

Figure: An example for the Label command.

Figure: An example for the Label command.

Figure: An example for the Label command.

Figure: An example for the Label command.

Figure: An example for the LightSource command.

Figure: An example for the ListCon command.

Figure: An example for the ListHBo command.

Figure: An example for the MakeImage command.

Figure: An example for the MakeImageObj command.

Figure: An example for the MakeTextObj command.

Figure: An example for the MakeWin command.

Figure: An example for the Oligomerize command.

Figure: An example for the OptimizeLoop command.

Figure: An example for the Optimize command.

Figure: An example for the Optimize command.

Figure: An example for the OriVec command.

Figure: An example for the pH command.

Figure: An example for the PolygonPar command.

Figure: An example for the Print command.

Figure: An example for the PrintHUD command.

Figure: An example for the RayTrace command.

Figure: An example for the RayTrace command.

Figure: An example for the RDF command.

Figure: An example for the SampleDih command.

Figure: An example for the SampleDih command.

Figure: An example for the SampleDih command.

Figure: An example for the SampleDih command.

Figure: An example for the SampleLoop command.

Figure: An example for the Scale command.

Figure: An example for the SecStr command.

Figure: An example for the Select command.

Figure: An example for the ShowArrow command.

Figure: An example for the ShowButton command.

Figure: An example for the ShowCavi command.

Figure: An example for the ShowCone command.

Figure: An example for the ShowCon command.

Figure: An example for the ShowESP command.

Figure: An example for the ShowHBo command.

Figure: An example for the ShowImage command.

Figure: An example for the ShowIonSites command.

Figure: An example for the ShowKBP command.

Figure: An example for the ShowKBP command.

Figure: An example for the ShowRota command.

Figure: An example for the ShowSecStr command.

Figure: An example for the ShowSecStr command.

Figure: An example for the ShowSecStr command.

Figure: An example for the ShowSimGrid command.

Figure: An example for the ShowSphere command.

Figure: An example for the ShowPolygon command.

Figure: An example for the ShowRing command.

Figure: An example for the ShowSkySphere command.

Figure: An example for the ShowSurf command.

Figure: An example for the ShowTab command.

Figure: An example for the ShowTorus command.

Figure: An example for the ShowTrace command.

Figure: An example for the ShowWire command.

Figure: An example for the Show command.

Figure: An example for the SolvEnergy command.

Figure: An example for the Stick command.

Figure: An example for the Style command.

Figure: An example for the Style command.

Figure: An example for the Style command.

Figure: An example for the SupMulti command.

Figure: An example for the Sup command.

Figure: An example for the SurfPar command.

Figure: An example for the SurfDis command.

Figure: An example for the SurfDis command.

Figure: An example for the SurfESP command.

Figure: An example for the Surf command.

Figure: An example for the SwapPosAtom command.

Figure: An example for the SwapRes command.

Figure: An example for the TempCtrl command.

Figure: An example for the Transformation command.

Figure: An example for the TypeAtom command.

Figure: An example for the TypeAtom command.

Figure: An example for the TypeBond command.