Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

° 

Structure determination

° 

Macros

Macros are written using the Yanaconda language. If you already know a programming language, you can learn Yanaconda in 15 minutes, otherwise it may take 30.

To install, just save the macro in the directory yasara/mcr or wherever you want it. The syntax of Yanaconda is described in the YASARA documentation.

° 

Solve an NMR structure with fixed quality

This macro solves an NMR structure based on a protein sequence and a restraint file in XPLOR format. Contrary to the normal nmr_solve macro, it refines only those structures in water, that match a quality criterion, and performs an unlimited number of folding runs until the ensemble has the requested size

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

° 

Solve an NMR structure

This macro solves an NMR structure based on a protein sequence and a restraint file in XPLOR format

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

Download: nmr_solve.mcr

° 

Set default parameters for NMR structure determination

This macro is included by others to set default parameters

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

° 

Refine an NMR ensemble in explicit solvent

This macro refines an NMR ensemble in explicit solvent to increase the accuracy

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

° 

Refine an NMR ensemble in vacuo

This macro refines a roughly folded structure in vacuo to create a realistic fold

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

° 

Fold an ensemble of NMR structures

This macro folds a structure from the stretched-out conformation using NMR restraints

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

Download: nmr_fold.mcr

° 

Analyze and merge an NMR ensemble

This macro analyzes an NMR ensemble and merges the members into a single PDB file

Written by: Elmar Krieger, Sander Nabuurs, Chris Spronk

License: GNU GPL

Last modified: 2012/01/19

Download: nmr_analyze.mcr