Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box  Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box  Binding Protein (1C9B)

° 

Structure prediction

° 

Macros

Macros are written using the Yanaconda language. If you already know a programming language, you can learn Yanaconda in 15 minutes, otherwise it may take 30.

To install, just save the macro in the directory yasara/mcr or wherever you want it. The syntax of Yanaconda is described in the YASARA documentation.

° 

Docking a ligand to a receptor

This macro predicts the structure of a ligand-receptor complex. It can also continue a docking run that got interrupted. An analysis log file is written at the end.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2010/08/22

Download: dock_run.mcr

° 

Docking a ligand to a receptor locally

This macro samples local ligand conformations in a user-supplied complex. An analysis log file is written at the end.

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2010/08/22

° 

Showing the docking results interactively

This macro cycles through the results of the various docking runs, and then shows the best complex in each cluster

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2010/08/22

Download: dock_play.mcr

° 

Building a homology model

This macro builds a homology model using a FASTA sequence of the target, and optionally template structures and alignments. It takes some shortcuts (alignment quality, number of templates, refinement) to finish as quickly as possible

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2010/05/30

° 

Building a homology model

This macro builds a homology model using a FASTA sequence of the target, and optionally template structures and alignments

Written by: Elmar Krieger

License: GNU GPL

Last modified: 2010/05/30

Download: hm_build.mcr