Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 


Download


Note: If you already downloaded YASARA once, don't do it again, but request an update instead.


Please customize your personal edition of
YASARA View

Your operating system:
Your processor:
If you know your processor, downloads will be smaller.

Please use only plain English characters in the fields below.
Your first name:
Your middle initials: (optional)
Your family name:  (optional but appreciated)
Department:  (optional but appreciated)
University/Company:  (optional but appreciated)
Your email address: (Download link will be sent there)
Please doublecheck the email address, it is essential for downloads, updates and support.



YASARA is linked with the Simple Direct Media Layer library which is released under the GNU LPGL. Click here for LGPL compliance information .